GSE302649 eCLIP Data Processing

eCLIP geo_data_processing 11 steps

Publication

High-resolution mapping of CCR4-NOT recruitment elements reveals transcriptome-wide drivers of mRNA decay.

Cell reports (2026) — PMID 42154591

Dataset

GSE302649

Mapping CCR4-NOT recruitment elements at high resolution reveals transcriptome-wide determinants of mRNA decay [miRNA-Seq]

Warning: Pipeline descriptions and code snippets may be inferred or AI-generated. Use them only as a starting point to guide analysis, and validate before use.

Processing Steps

Generate Jupyter Notebook
  1. 1

    TruSeq sequence adapters were trimmed from the eCLIP-seq reads with cutadapt (Version: 4.2.

    cutadapt v4.2
  2. 2

    Options: version--match-read-wildcards, --error-rate 0.1 --overlap 3, --nextseq-trim 5, --minimum-length 40, --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) [PMID: 28715235].

  3. 3

    The UMI barcode was extracted from the 3’ end of the reads and added to the read name using umi_tools (Version: 1.1.4.

    UMI-tools v1.1.4
  4. 4

    Options: extract --3prime –extract-method=string, --bc-pattern NNNNNNNNNNNN) [PMID: 28100584].

  5. 5

    Qiaseq miRNA adapters were removed from the 3’ end of the reads with cutadapt (Version: 4.2.

    cutadapt v4.2
  6. 6

    Options: --match-read-wildcards --times 1 --error-rate 0 --overlap 19, --adapter AACTGTAGGCACCATCAAT --minimum-length 5) [PMID: 28715235].

  7. 7

    Reads were deduplicated by the UMI barcode using UMIcollapse (Version: 1.0.0) [PMID: 31871845].

  8. 8

    Reads were aligned to the GRCh38 build of the human genome with STAR (Version: 2.7.11, Options: --alignEndsType EndToEnd, --limitOutSJcollapsed 5000000, --outFilterScoreMin 10, --outFilterMismatchNoverLmax 0.6, --outFilterMultimapNmax 5) [PMID: 23104886].

    STAR v2.7.11
  9. 9

    Reads mapping to rRNA and ENCODE blacklisted regions were removed [PMID: 33590861].

  10. 10

    Cluster identification was performed on the aligned reads using CLIPper (Version: ­2.0.1, Option: species GRCh38).

    CLIPper v2.0.1
  11. 11

    The software build was run from an Apptainer environment (Obtained from: docker:brianyee/clipper:Osativa7_branch) [PMID: 19136955, and PMID: 24213538].

    CLIPper
Raw Source Text 
TruSeq sequence adapters were trimmed from the eCLIP-seq reads with cutadapt (Version: 4.2. Options: version--match-read-wildcards, --error-rate 0.1 --overlap 3, --nextseq-trim 5, --minimum-length 40, --adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) [PMID: 28715235].
The UMI barcode was extracted from the 3’ end of the reads and added to the read name using umi_tools (Version: 1.1.4. Options: extract --3prime –extract-method=string, --bc-pattern NNNNNNNNNNNN) [PMID: 28100584].
Qiaseq miRNA adapters were removed from the 3’ end of the reads with cutadapt (Version: 4.2. Options: --match-read-wildcards --times 1 --error-rate 0 --overlap 19, --adapter AACTGTAGGCACCATCAAT --minimum-length 5) [PMID: 28715235].
Reads were deduplicated by the UMI barcode using UMIcollapse (Version: 1.0.0) [PMID: 31871845].
Reads were aligned to the GRCh38 build of the human genome with STAR (Version: 2.7.11, Options: --alignEndsType EndToEnd, --limitOutSJcollapsed 5000000, --outFilterScoreMin 10, --outFilterMismatchNoverLmax 0.6, --outFilterMultimapNmax 5) [PMID: 23104886].
Reads mapping to rRNA and ENCODE blacklisted regions were removed [PMID: 33590861].
Cluster identification was performed on the aligned reads using CLIPper (Version: ­2.0.1, Option: species GRCh38). The software build was run from an Apptainer environment (Obtained from: docker:brianyee/clipper:Osativa7_branch) [PMID: 19136955, and PMID: 24213538].
Assembly: GRCh38
Supplementary files format and content: CLIPper peaks as bed files
← Back to Analysis