GSE180129
GSE GEOGlobal Identification of the miR-130a targetome in human HSPC Reveals a Novel Role for TBL1XR1 in Hematopoietic Stem Cell Self-Renewal and t(8;21) AML
Organism:
Homo sapiens
Platform:
GPL24676
Samples:
9
Experiment Types:
Other
Submitted:
Jul 14 2021
Last Updated:
Jul 01 2024
Status:
Public on Mar 08 2022
Contact:
Gene,,Yeo (UCSD)
Relations
SubSeries of: GSE181140
BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA746604
SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP328366
Summary
Gene expression profiling and proteome analysis of normal and malignant hematopoietic stem cells (HSC) point to shared core stemness properties. However, discordance between mRNA and protein signatures underscores an important role for post-transcriptional regulation by miRNAs in governing this critical nexus. Here, we identify miR-130a as a regulator of HSC self-renewal and differentiation. Integration of protein mass spectrometry and chimeric AGO2 eCLIP-seq identify TBL1XR1 as a primary miR-130a target. TBL1XR1 loss of function phenocopies miR-130a enforced expression impairing lymphoid differentiation and expanding long-term (LT)-HSC. This post-transcriptional regulation by miR-130a is usurped in t(8;21) acute myeloid leukemia (AML), whereby reduction of miR-130a results in differentiation of leukemic cells by altering chromatin binding and composition of the AML1-ETO complex. Our study establishes that comprehensive identification of the miRNA targetome within primary cells enables discovery of novel genes and molecular networks underpinning stemness properties of normal and leukemic cells.
Overall Design
Identification of miR-130a targets using transcriptome-wide chimeric AGO2 eCLIP-seq and miR-130a targeted chimeric AGO2 eCLIP-seq in CD34+ hematopoietic stem and progenitor cells (HSPC) and Kasumi-1 AML cell line
Analysis (24 steps)
View Data Processing
Processing steps for GSE180129
- Sequenced reads were reformatted to include randomers in read headers with umi_tools (1.0.0).
- Args: --random-seed 1 --bc-pattern NNNNNNNNNN
- Reads were then trimmed with cutadapt (1.14).
- Args: --match-read-wildcards -O 1 --times 1 -e 0.1 --quality-cutoff 6 -m 18 -a InvRNA*.fasta (fasta sequences can be found at: https://github.com/YeoLab/eclip/tree/master/example/inputs/)
- Reads were then trimmed again with cutadapt (1.14) to remove double-ligation events.
- Args: --match-read-wildcards -O 5 --times 1 -e 0.1 --quality-cutoff 6 -m 18 -a Ril19.fasta (fasta sequences can be found at: https://github.com/YeoLab/eclip/tree/master/example/inputs/)
- For targeted miR-130a datasets, reads that did not contain the primer sequence (CAGUGCAAUGUUAAAAGGGCAU) were filtered out.
- For total chimeric eCLIP datasets, 10nt from the 3'end of Read1 was trimmed with umi_tools.
Showing first 8 steps.
Supplementary Files (2)
GEO Samples (9)
Dataset Citations (1)
Identification of the global miR-130a targetome reveals a role for TBL1XR1 in hematopoietic stem cell self-renewal and t(8;21) AML.
PMID 35263585
· 2022
· Cell reports
Gabriela Krivdova, Veronique Voisin, Erwin M Schoof, Sajid A Marhon, Alex Murison, Jessica L McLeod, Martino M Gabra, Andy G X Zeng, Stefan Aigner, Brian A Yee, Alexander A Shishkin, Eric L Van Nostrand, Karin G Hermans, Aaron C Trotman-Grant, Nathan Mbong, James A Kennedy, Olga I Gan, Elvin Wagenblast, Daniel D De Carvalho, Leonardo Salmena, Mark D Minden, Gary D Bader, Gene W Yeo, John E Dick, Eric R Lechman
SRA Experiments (9) and Runs (9)
Total: 16685 MBGSM5453665: cells B total chimeric eCLIP, rep 1; Homo sapiens; RIP-Seq
Sample: SRS9489969
BioProject: PRJNA746604
BioSample: SAMN20222622
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: CD34+ cord blood
tissue: CD34+ cord blood
cell type: Lineage-depleted human cord blood cells sorted to collect CD34+ CB cells
rip antibody: AGO2 clone 4F9 (Santa Cruz, sc-53521)
inline barcode1: Ril19
Original files (1)
CD34+ cord blood
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR15142308 | 36085496 | 7289270192 | 2208.71 | Au2_S2_L001_R1_001.fastq.gz, Au2_S2_L001_R2_001.fastq.gz, SRR15142308… | SRA |
GSM5453666: cells B total chimeric eCLIP, rep 2; Homo sapiens; RIP-Seq
Sample: SRS9489970
BioProject: PRJNA746604
BioSample: SAMN20222621
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: CD34+ cord blood
tissue: CD34+ cord blood
cell type: Lineage-depleted human cord blood cells sorted to collect CD34+ CB cells
rip antibody: AGO2 clone 4F9 (Santa Cruz, sc-53521)
inline barcode1: Ril19
Original files (1)
CD34+ cord blood
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR15142309 | 32429965 | 6550852930 | 2017.52 | Au3_S3_L001_R1_001.fastq.gz, Au3_S3_L001_R2_001.fastq.gz, SRR15142309… | SRA |
GSM5453667: cells B total chimeric eCLIP size-matched input, rep 1; Homo sapiens; RIP-Seq
Sample: SRS9489971
BioProject: PRJNA746604
BioSample: SAMN20222620
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: CD34+ cord blood
tissue: CD34+ cord blood
cell type: Lineage-depleted human cord blood cells sorted to collect CD34+ CB cells
rip antibody: none
inline barcode1: Ril19
Original files (1)
CD34+ cord blood
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR15142310 | 29286571 | 5915887342 | 1876.67 | Au6_S6_L001_R1_001.fastq.gz, Au6_S6_L001_R2_001.fastq.gz, SRR15142310… | SRA |
GSM5453668: cells B total chimeric eCLIP size-matched input, rep 2; Homo sapiens; RIP-Seq
Sample: SRS9489972
BioProject: PRJNA746604
BioSample: SAMN20222619
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: CD34+ cord blood
tissue: CD34+ cord blood
cell type: Lineage-depleted human cord blood cells sorted to collect CD34+ CB cells
rip antibody: none
inline barcode1: Ril19
Original files (1)
CD34+ cord blood
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR15142311 | 26374635 | 5327676270 | 1675.44 | Au7_S7_L001_R1_001.fastq.gz, Au7_S7_L001_R2_001.fastq.gz, SRR15142311… | SRA |
GSM5453669: cells B hsa-miR-130a targeted chimeric eCLIP; Homo sapiens; RIP-Seq
Sample: SRS9489973
BioProject: PRJNA746604
BioSample: SAMN20222618
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: CD34+ cord blood
tissue: CD34+ cord blood
cell type: Lineage-depleted human cord blood cells sorted to collect CD34+ CB cells
rip antibody: AGO2 clone 4F9 (Santa Cruz, sc-53521)
inline barcode1: Ril19
Original files (1)
CD34+ cord blood
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR15142312 | 9445872 | 1908066144 | 583.01 | Au13_S13_L001_R1_001.fastq.gz, Au13_S13_L001_R2_001.fastq.gz, SRR1514… | SRA |
GSM5453670: cells C hsa-miR-130a targeted chimeric eCLIP; Homo sapiens; RIP-Seq
Sample: SRS9489974
BioProject: PRJNA746604
BioSample: SAMN20222617
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: Kasumi-1
cell line: t(8;21) AML cell line Kasumi-1
rip antibody: AGO2 clone 4F9 (Santa Cruz, sc-53521)
inline barcode1: Ril19
Original files (1)
Kasumi-1
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR15142313 | 7211775 | 1456778550 | 453.79 | Au9_S9_L001_R1_001.fastq.gz, Au9_S9_L001_R2_001.fastq.gz, SRR15142313… | SRA |
GSM5470531: Kasumi-1 total chimeric eCLIP; Homo sapiens; OTHER
Sample: SRS9577336
BioProject: PRJNA746604
BioSample: SAMN20370371
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: Kasumi-1
antibody manufacturer: AGO2 clone 4F9, Santa Cruz
tissue: t(8;21) AML cell line
inline barcode1: Ril19
Original files (1)
Kasumi-1
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR15236468 | 62838139 | 12693304078 | 3903.21 | Au1_S1_L001_R1_001.fastq.gz, Au1_S1_L001_R2_001.fastq.gz, SRR15236468… | SRA |
GSM5470532: Kasumi-1 total chimeric eCLIP size-matched input; Homo sapiens; OTHER
Sample: SRS9577337
BioProject: PRJNA746604
BioSample: SAMN20370370
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: Kasumi-1
antibody manufacturer: AGO2 clone 4F9, Santa Cruz
tissue: t(8;21) AML cell line
inline barcode1: Ril19
Original files (1)
Kasumi-1
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR15236469 | 49869528 | 10073644656 | 3206.93 | Au5_S5_L001_R1_001.fastq.gz, Au5_S5_L001_R2_001.fastq.gz, SRR15236469… | SRA |
GSM5733559: cells B hsa-miR-130a targeted chimeric eCLIP_2; Homo sapiens; RIP-Seq
Sample: SRS11337245
BioProject: PRJNA746604
BioSample: SAMN24036810
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: CD34+ cord blood
tissue: CD34+ cord blood
cell type: Lineage-depleted human cord blood cells
rip antibody: AGO2 clone 4F9 (Santa Cruz, sc-53521)
inline barcode1: Inline barcode1: Ril19
Original files (1)
CD34+ cord blood
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR17259466 | 12057828 | 2435681256 | 759.69 | Au14_S14_L001_R1_001.fastq.gz, Au14_S14_L001_R2_001.fastq.gz, SRR1725… | SRA |
Linked Publications (1)
Data Files (9)
| Accession | File Name | Stored Type | Output Type | Mapping Assembly | Size | Download | |
|---|---|---|---|---|---|---|---|
| — | Au1_S1_L001_R1_001.fastq.gz | OTHER | 3.8 GB | link | |||
| — | Au5_S5_L001_R1_001.fastq.gz | OTHER | 3.1 GB | link | |||
| — | Au13_S13_L001_R1_001.fastq.gz | RIP-Seq | 583.0 MB | link | |||
| — | Au14_S14_L001_R1_001.fastq.gz | RIP-Seq | 759.7 MB | link | |||
| — | Au2_S2_L001_R1_001.fastq.gz | RIP-Seq | 2.2 GB | link | |||
| — | Au3_S3_L001_R1_001.fastq.gz | RIP-Seq | 2.0 GB | link | |||
| — | Au6_S6_L001_R1_001.fastq.gz | RIP-Seq | 1.8 GB | link | |||
| — | Au7_S7_L001_R1_001.fastq.gz | RIP-Seq | 1.6 GB | link | |||
| — | Au9_S9_L001_R1_001.fastq.gz | RIP-Seq | 453.8 MB | link |