GSE69583
GSE GEOMusashi-2 Post-transcriptionally Attenuates Aryl Hydrocarbon Receptor Signaling to Expand Human Hematopoietic Stem Cells
Relations
Summary
A greater understanding of the molecular pathways that underpin the unique human hematopoietic stem and progenitor cell (HSPC) self-renewal program will improve strategies to expand these critical cell types for regenerative therapies. The post-transcriptional mechanisms guiding HSPC fate during ex vivo expansion have not been closely investigated. Using shRNA-mediated knockdown, we show that the RNA-binding protein (RBP) Musashi-2 (MSI2) is required for human HSPC self-renewal. Conversely, when overexpressed, MSI2 induces multiple pro-self-renewal phenotypes, including significant ex vivo expansion of short- and long-term repopulating cells through direct attenuation of aryl hydrocarbon receptor (AHR) signaling. Using a global analysis of MSI2-RNA interactions, we determined that MSI2 post-transcriptionally downregulates canonical AHR pathway components in cord blood HSPCs. Our study provides new mechanistic insight into RBP-controlled RNA networks that underlie the self-renewal process and provides evidence that manipulating such networks can provide a novel means to enhance the regenerative potential of human HSPCs expanded ex vivo.
Overall Design
CLIP-seq against MSI2 in NB4 Cells
Analysis (7 steps)
View Data Processing- Sequencing reads from CLIP-seq and RIP-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
- Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
- Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
- Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within âoutFilterMultimapNmax 1 âoutFilterMultimapScoreRange 1.
- Reads that were PCR replicates were removed from each CLIP-seq library using a custom script.
- Briefly one read was kept at each nucleotide position when more than one readâs 5' end was mapped
- Clusters were then assigned using the CLIPper software with parameters --bonferroni --superlocal --threshold- software (Lovci et al., 2013).
Supplementary Files (1)
GEO Samples (2)
Dataset Citations (1)
SRA Experiments (2) and Runs (2)
Total: 2746 MBSample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051419 | 60059965 | 3002998250 | 1125.78 | MSI2_ACAGTG_ACAGTG_L008_R1.fastq.gz, SRR2051419, SRR2051419.sralite | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051420 | 86861473 | 4343073650 | 1620.39 | MSI2_TTAGGC_TTAGGC_L008_R1.fastq.gz, SRR2051420, SRR2051420.sralite | SRA |