← All datasets

GSE69583

GSE GEO
View on GEO Export SRA CSV

Musashi-2 Post-transcriptionally Attenuates Aryl Hydrocarbon Receptor Signaling to Expand Human Hematopoietic Stem Cells

Organism: Homo sapiens
Platform: GPL11154
Samples: 2
Experiment Types:
Other
Submitted: Jun 04 2015
Last Updated: May 15 2019
Status: Public on Apr 27 2016
Contact: Gene,,Yeo (UCSD)

Relations

BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA285905 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP059078

Summary

A greater understanding of the molecular pathways that underpin the unique human hematopoietic stem and progenitor cell (HSPC) self-renewal program will improve strategies to expand these critical cell types for regenerative therapies. The post-transcriptional mechanisms guiding HSPC fate during ex vivo expansion have not been closely investigated. Using shRNA-mediated knockdown, we show that the RNA-binding protein (RBP) Musashi-2 (MSI2) is required for human HSPC self-renewal. Conversely, when overexpressed, MSI2 induces multiple pro-self-renewal phenotypes, including significant ex vivo expansion of short- and long-term repopulating cells through direct attenuation of aryl hydrocarbon receptor (AHR) signaling. Using a global analysis of MSI2-RNA interactions, we determined that MSI2 post-transcriptionally downregulates canonical AHR pathway components in cord blood HSPCs. Our study provides new mechanistic insight into RBP-controlled RNA networks that underlie the self-renewal process and provides evidence that manipulating such networks can provide a novel means to enhance the regenerative potential of human HSPCs expanded ex vivo.

Overall Design

CLIP-seq against MSI2 in NB4 Cells

Analysis (7 steps)

View Data Processing
Processing steps for GSE69583
  1. Sequencing reads from CLIP-seq and RIP-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
  2. Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
  3. Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
  4. Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1.
  5. Reads that were PCR replicates were removed from each CLIP-seq library using a custom script.
  6. Briefly one read was kept at each nucleotide position when more than one read’s 5' end was mapped
  7. Clusters were then assigned using the CLIPper software with parameters --bonferroni --superlocal --threshold- software (Lovci et al., 2013).

Supplementary Files (1)

GSE69583_RAW.tar Download
GEO Samples (2)

Dataset Citations (1)

Musashi-2 attenuates AHR signalling to expand human haematopoietic stem cells.
PMID 27121842 · 2016 · Nature
Stefan Rentas, Nicholas Holzapfel, Muluken S Belew, Gabriel Pratt, Veronique Voisin, Brian T Wilhelm, Gary D Bader, Gene W Yeo, Kristin J Hope

SRA Experiments (2) and Runs (2)

Total: 2746 MB
SRX1048847 SRP059078 OTHER SINGLE
GSM1704212: MSI2 Rep 1; Homo sapiens; OTHER
Sample: SRS953166
BioProject: PRJNA285905
BioSample: SAMN03761795
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: NB4 cell line
antibody: MSI2
antibody manufacturer: Abcam
cell line: NB4 (Human Acute Promyelocytic Leukemia Cells)
Original files (1)
NB4 cell line
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051419 60059965 3002998250 1125.78 MSI2_ACAGTG_ACAGTG_L008_R1.fastq.gz, SRR2051419, SRR2051419.sralite SRA
SRX1048848 SRP059078 OTHER SINGLE
GSM1704213: MSI2 Rep 2; Homo sapiens; OTHER
Sample: SRS953165
BioProject: PRJNA285905
BioSample: SAMN03761796
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: NB4 cell line
antibody: MSI2
antibody manufacturer: Abcam
cell line: NB4 (Human Acute Promyelocytic Leukemia Cells)
Original files (1)
NB4 cell line
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051420 86861473 4343073650 1620.39 MSI2_TTAGGC_TTAGGC_L008_R1.fastq.gz, SRR2051420, SRR2051420.sralite SRA

Linked Publications (1)

Data Files (2)

Accession File Name Stored Type Output Type Mapping Assembly Size Download
MSI2_ACAGTG_ACAGTG_L008_R1.fastq.gz OTHER 1.1 GB link
MSI2_TTAGGC_TTAGGC_L008_R1.fastq.gz OTHER 1.6 GB link