GSE90650
GSE GEOThe LncRNA NEAT1 Nests RNA Binding Proteins and the Microprocessor to Globally Enhance Pri-miRNA Processing
Organism:
Homo sapiens
Platform:
GPL20301
Samples:
16
Experiment Types:
Other
Non-coding RNA profiling by high throughput sequencing
Submitted:
Nov 29 2016
Last Updated:
May 15 2019
Status:
Public on Jul 26 2017
Contact:
Xiang-Dong,,Fu (UC San Diego)
Relations
BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA355281
SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP094056
Summary
MicroRNA biogenesis is known to be modulated by a variety of RNA binding proteins (RBPs), but in most cases, individual RBPs appear to influence the processing of a small number of selective targets. We herein report binding of the NONO/PSF heterodimer to hundreds of expressed pri-miRNAs in HeLa cells to globally enhance pri-miRNA processing by the Drosha/DGCR8 Microprocessor. As NONO/PSF are key components of paraspeckles organized by the lncRNA NEAT1, we find that NEAT1 also has profound effects on global pri-miRNA processing. Mechanistic dissection reveals that NEAT1 broadly interacts with NONO/PSF as well as many other RBPs, and that multiple RNA segments in NEAT1, including a âpseudo pri-miRNAâ near its 3â end, help attract the Microprocessor. These findings suggest a bird nest model for a large lncRNA to orchestrate efficient processing of an entire class of small RNAs in the nucleus.we used small RNA-seq to identify miRNA level in response to secific knockdowns relative to siGFP treatment control
Overall Design
We profiled the miRNAs expression levels under conditions including siGFP(control), siNEAT1, siNEAT1_V2, siNONO, siPSF and siPSPC1 through small RNA-seq respectively. And we also examined the in vivo interactions between NONO/PSF and RNA through CLIP-seq.
Analysis (6 steps)
View Data Processing
Processing steps for GSE90650
- For each CLIP-seq read, the first 4nt index sequence was extracted and the 3'-adaptor sequence CTCGTATGCCGTCTTCTGCTTG was removed with program cutadapt (version 1.8.3).
- The reads with at least 18nt were mapped to the human genome (hg19) by Bowtie (version 1.1.1) with parameters '-l25 -n2 -k1 -m10 -e 200 --best --strata'.
- For each small RNA-seq read, the firsst 5nt NNNTC was extracted and 3' adaptor sequence 'NNCTCGTATGCCGTCTTCTGCTTG' was removed with program cutadapt (version 1.8.3).
- The target insert sequences were required to be at least 16 nt.
- The filtered reads were mapped to the genome genome (hg19) by Bowtie (version 1.1.1) with parameters '-n 0 -e 80 -l 18 -a -m 5 --best --strata'.
- The mapped reads were used to generate the genomic coverage profiles in bigWig format with programs genomeCoverageBed (bedtools version 2.24) and samtools (version 0.1.19).
Supplementary Files (1)
GSE90650_RAW.tar
Download
Dataset Citations (1)
NEAT1 scaffolds RNA-binding proteins and the Microprocessor to globally enhance pri-miRNA processing.
PMID 28846091
· 2017
· Nature structural & molecular biology
Li Jiang, Changwei Shao, Qi-Jia Wu, Geng Chen, Jie Zhou, Bo Yang, Hairi Li, Lan-Tao Gou, Yi Zhang, Yangming Wang, Gene W Yeo, Yu Zhou, Xiang-Dong Fu
SRA Experiments (16) and Runs (16)
Total: 13665 MBGSM2409885: siGFP-1; Homo sapiens; ncRNA-Seq
Sample: SRS1823653
BioProject: PRJNA355281
BioSample: SAMN06067920
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siGFP(control )
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060656 | 1724531 | 68981240 | 57.88 | siGFP-1.fastq.gz, SRR5060656, SRR5060656.sralite | SRA |
GSM2409886: siGFP-2; Homo sapiens; ncRNA-Seq
Sample: SRS1823654
BioProject: PRJNA355281
BioSample: SAMN06067919
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siGFP(control)
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060657 | 22933611 | 917344440 | 776.71 | siGFP-2.fastq.gz, SRR5060657, SRR5060657.sralite | SRA |
GSM2409887: siNEAT1-1; Homo sapiens; ncRNA-Seq
Sample: SRS1823655
BioProject: PRJNA355281
BioSample: SAMN06067918
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siNEAT1
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060658 | 25457001 | 1018280040 | 860.81 | siNEAT1-1.fastq.gz, SRR5060658, SRR5060658.sralite | SRA |
GSM2409888: siNEAT1-2; Homo sapiens; ncRNA-Seq
Sample: SRS1823656
BioProject: PRJNA355281
BioSample: SAMN06067923
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siNEAT1
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060659 | 23768875 | 950755000 | 804.74 | siNEAT1-2.fastq.gz, SRR5060659, SRR5060659.sralite | SRA |
GSM2409889: siNEAT1_V2-1; Homo sapiens; ncRNA-Seq
Sample: SRS1823657
BioProject: PRJNA355281
BioSample: SAMN06067924
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siNEAT1_V2
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060660 | 5045631 | 201825240 | 170.16 | siNEAT1_V2-1.fastq.gz, SRR5060660, SRR5060660.sralite | SRA |
GSM2409890: siNEAT1_V2-2; Homo sapiens; ncRNA-Seq
Sample: SRS1823658
BioProject: PRJNA355281
BioSample: SAMN06067906
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siNEAT1_V2
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060661 | 29749402 | 1189976080 | 1016.98 | siNEAT1_V2-2.fastq.gz, SRR5060661, SRR5060661.sralite | SRA |
GSM2409891: siNONO-1; Homo sapiens; ncRNA-Seq
Sample: SRS1823659
BioProject: PRJNA355281
BioSample: SAMN06067911
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siNONO
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060662 | 10103859 | 404154360 | 343.48 | siNONO-1.fastq.gz, SRR5060662, SRR5060662.sralite | SRA |
GSM2409892: siNONO-2; Homo sapiens; ncRNA-Seq
Sample: SRS1823660
BioProject: PRJNA355281
BioSample: SAMN06067912
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siNONO
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060663 | 36777772 | 1471110880 | 1255.73 | siNONO-2.fastq.gz, SRR5060663, SRR5060663.sralite | SRA |
GSM2409893: siPSF-1; Homo sapiens; ncRNA-Seq
Sample: SRS1823661
BioProject: PRJNA355281
BioSample: SAMN06067915
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siPSF
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060664 | 13578674 | 543146960 | 462.85 | siPSF-1.fastq.gz, SRR5060664, SRR5060664.sralite | SRA |
GSM2409894: siPSF-2; Homo sapiens; ncRNA-Seq
Sample: SRS1823662
BioProject: PRJNA355281
BioSample: SAMN06067914
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siPSF
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060665 | 15482683 | 619307320 | 526.99 | siPSF-2.fastq.gz, SRR5060665, SRR5060665.sralite | SRA |
GSM2409895: siPSPC1-1; Homo sapiens; ncRNA-Seq
Sample: SRS1823663
BioProject: PRJNA355281
BioSample: SAMN06067916
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siPSPC1
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060666 | 11158436 | 446337440 | 374.65 | siPSPC1-1.fastq.gz, SRR5060666, SRR5060666.sralite | SRA |
GSM2409896: siPSPC1-2; Homo sapiens; ncRNA-Seq
Sample: SRS1823664
BioProject: PRJNA355281
BioSample: SAMN06067925
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
sirna: siPSPC1
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060667 | 17816451 | 712658040 | 606.88 | siPSPC1-2.fastq.gz, SRR5060667, SRR5060667.sralite | SRA |
GSM2409897: NONO-1; Homo sapiens; OTHER
Sample: SRS1823665
BioProject: PRJNA355281
BioSample: SAMN06067907
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
antibody: NONO
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060668 | 26415727 | 1056629080 | 933.8 | NONO-1.fastq.gz, SRR5060668, SRR5060668.sralite | SRA |
GSM2409898: NONO-2; Homo sapiens; OTHER
Sample: SRS1823666
BioProject: PRJNA355281
BioSample: SAMN06067917
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
antibody: NONO
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060669 | 46283427 | 1851337080 | 1665.77 | NONO-2.fastq.gz, SRR5060669, SRR5060669.sralite | SRA |
GSM2409899: PSF-1; Homo sapiens; OTHER
Sample: SRS1823667
BioProject: PRJNA355281
BioSample: SAMN06067910
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
antibody: PSF
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060670 | 62766102 | 2510644080 | 2240.68 | PSF-1.fastq.gz, SRR5060670, SRR5060670.sralite | SRA |
GSM2409900: PSF-2; Homo sapiens; OTHER
Sample: SRS1823668
BioProject: PRJNA355281
BioSample: SAMN06067909
Platform: ILLUMINA
Instrument: Illumina HiSeq 4000
Organism: Homo sapiens
Sample attributes
source_name: cervical adenocarcinoma
cell type: HeLa cell
antibody: PSF
Original files (1)
cervical adenocarcinoma
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR5060671 | 44013620 | 1760544800 | 1566.89 | PSF-2.fastq.gz, SRR5060671, SRR5060671.sralite | SRA |
Linked Publications (1)
NEAT1 scaffolds RNA-binding proteins and the Microprocessor to globally enhance pri-miRNA processing.
Nature structural & molecular biology · 2017
Data Files (16)
| Accession | File Name | Stored Type | Output Type | Mapping Assembly | Size | Download | |
|---|---|---|---|---|---|---|---|
| — | siGFP-1.fastq.gz | ncRNA-Seq | 57.9 MB | link | |||
| — | siGFP-2.fastq.gz | ncRNA-Seq | 776.7 MB | link | |||
| — | siNEAT1-1.fastq.gz | ncRNA-Seq | 860.8 MB | link | |||
| — | siNEAT1-2.fastq.gz | ncRNA-Seq | 804.7 MB | link | |||
| — | siNEAT1_V2-1.fastq.gz | ncRNA-Seq | 170.2 MB | link | |||
| — | siNEAT1_V2-2.fastq.gz | ncRNA-Seq | 1017.0 MB | link | |||
| — | siNONO-1.fastq.gz | ncRNA-Seq | 343.5 MB | link | |||
| — | siNONO-2.fastq.gz | ncRNA-Seq | 1.2 GB | link | |||
| — | siPSF-1.fastq.gz | ncRNA-Seq | 462.8 MB | link | |||
| — | siPSF-2.fastq.gz | ncRNA-Seq | 527.0 MB | link | |||
| — | siPSPC1-1.fastq.gz | ncRNA-Seq | 374.6 MB | link | |||
| — | siPSPC1-2.fastq.gz | ncRNA-Seq | 606.9 MB | link | |||
| — | NONO-1.fastq.gz | OTHER | 933.8 MB | link | |||
| — | NONO-2.fastq.gz | OTHER | 1.6 GB | link | |||
| — | PSF-1.fastq.gz | OTHER | 2.2 GB | link | |||
| — | PSF-2.fastq.gz | OTHER | 1.5 GB | link |