GSE77704

GSE GEO

View on GEO Export SRA CSV

Distinct and shared functions of ALS-associated TDP-43, FUS, and TAF15 revealed by comprehensive multi-system integrative analyses [RNA-Seq_Stability]

Organism: Homo sapiens

Platform: GPL11154

Samples: 18

Experiment Types:

Expression profiling by high throughput sequencing

Submitted: Feb 08 2016

Last Updated: May 15 2019

Status: Public on Jul 05 2016

Contact: Gene,,Yeo (UCSD)

Relations

SubSeries of: GSE77707 BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA311240 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP069789

Summary

TDP-43, FUS, and TAF15 are implicated in amyotrophic lateral sclerosis (ALS) and frontotemporal dementia. We integrate CLIP-seq and RNA Bind-N-Seq technologies to discover that TAF15 binds to ~4,900 RNAs enriched for GGUA motifs. In the mouse brain, TAF15 and FUS, but not TDP-43, exhibit strikingly similar RNA binding profiles, yet they alter the expression of distinct mRNA populations upon their individual depletions. TAF15 has a minimal role in alternative splicing and instead affects RNA turnover, consistent with an enrichment of TAF15 binding sites in 3â untranslated regions. In human stem cell-derived motor neurons, loss of both TAF15 and FUS affected mRNAs distinct from those altered by loss of either protein alone, revealing redundant roles for TAF15 and FUS in maintaining mRNA levels. Furthermore, concomitant rather than individual depletion of TAF15 and FUS more closely resembles RNA profiles of motor neurons derived from FUS R521G ALS patients or from late-stage, sporadic ALS patients. Our study reveals convergent and divergent mechanisms by which FUS, TAF15 and TDP-43 affects RNA metabolism in neurological disease.

Overall Design

RNA-seq, CLIP-seq and arrays in mouse and human against TAF15 knockdowns This Series represents RNA-seq sample(s).

Analysis (5 steps)

View Data Processing

Processing steps for GSE77704

RNA-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within âoutFilterMultimapNmax 1 âoutFilterMultimapScoreRange 1.
counts of reads for each gene annotated in gencode v17 were calculated from featureCounts

Supplementary Files (1)

GSE77704_RAW.tar Download

GEO Samples (18)

GSM2056814 GSM2056815 GSM2056816 GSM2056817 GSM2056818 GSM2056819 GSM2056820 GSM2056821 GSM2056822 GSM2056823 GSM2056824 GSM2056825 GSM2056826 GSM2056827 GSM2056828 GSM2056829 GSM2056830 GSM2056831

Dataset Citations (1)

Distinct and shared functions of ALS-associated proteins TDP-43, FUS and TAF15 revealed by multisystem analyses.

PMID 27378374 · 2016 · Nature communications

Katannya Kapeli, Gabriel A Pratt, Anthony Q Vu, Kasey R Hutt, Fernando J Martinez, Balaji Sundararaman, Ranjan Batra, Peter Freese, Nicole J Lambert, Stephanie C Huelga, Seung J Chun, Tiffany Y Liang, Jeremy Chang, John P Donohue, Lily Shiue, Jiayu Zhang, Haining Zhu, Franca Cambi, Edward Kasarskis, Shawn Hoon, Manuel Ares, Christopher B Burge, John Ravits, Frank Rigo, Gene W Yeo

SRA Experiments (18) and Runs (18)

Total: 7627 MB

SRX1566087 SRP069789 RNA-Seq SINGLE

GSM2056814: Ctrl 0m; Homo sapiens; RNA-Seq

Sample: SRS1280232

BioProject: PRJNA311240

BioSample: SAMN04480978

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: Ctrl 0m

cell type: NPC

knockdown: ctrl

agent: Actinomycin D

time: 0m

Original files (1)

Ctrl 0m

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153311	13447673	672383650	402.58	NPC0_ctrl.fastq.gz, SRR3153311, SRR3153311.sralite	SRA

SRX1566088 SRP069789 RNA-Seq SINGLE

GSM2056815: FUS KD 0m; Homo sapiens; RNA-Seq

Sample: SRS1280231

BioProject: PRJNA311240

BioSample: SAMN04480979

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS KD 0m

cell type: NPC

knockdown: FUS

agent: Actinomycin D

time: 0m

Original files (1)

FUS KD 0m

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153312	7266698	363334900	219.39	NPC0_FUS.fastq.gz, SRR3153312, SRR3153312.sralite	SRA

SRX1566089 SRP069789 RNA-Seq SINGLE

GSM2056816: TAF15 KD 0m; Homo sapiens; RNA-Seq

Sample: SRS1280230

BioProject: PRJNA311240

BioSample: SAMN04480980

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TAF15 KD 0m

cell type: NPC

knockdown: TAF15

agent: Actinomycin D

time: 0m

Original files (1)

TAF15 KD 0m

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153313	2278634	113931700	66.08	NPC0_TAF15.fastq.gz, SRR3153313, SRR3153313.sralite	SRA

SRX1566090 SRP069789 RNA-Seq SINGLE

GSM2056817: Ctrl 15m; Homo sapiens; RNA-Seq

Sample: SRS1280229

BioProject: PRJNA311240

BioSample: SAMN04480981

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: Ctrl 15m

cell type: NPC

knockdown: ctrl

agent: Actinomycin D

time: 15m

Original files (1)

Ctrl 15m

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153314	51107630	2555381500	1619.36	NPC15_ctrl.fastq.gz, SRR3153314, SRR3153314.sralite	SRA

SRX1566091 SRP069789 RNA-Seq SINGLE

GSM2056818: FUS KD 15m; Homo sapiens; RNA-Seq

Sample: SRS1280228

BioProject: PRJNA311240

BioSample: SAMN04480982

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS KD 15m

cell type: NPC

knockdown: FUS

agent: Actinomycin D

time: 15m

Original files (1)

FUS KD 15m

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153315	11177713	558885650	361.16	NPC15_FUS.fastq.gz, SRR3153315, SRR3153315.sralite	SRA

SRX1566092 SRP069789 RNA-Seq SINGLE

GSM2056819: TAF15 KD 15m; Homo sapiens; RNA-Seq

Sample: SRS1280227

BioProject: PRJNA311240

BioSample: SAMN04480962

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TAF15 KD 15m

cell type: NPC

knockdown: TAF15

agent: Actinomycin D

time: 15m

Original files (1)

TAF15 KD 15m

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153316	5014992	250749600	157.13	NPC15_TAF15.fastq.gz, SRR3153316, SRR3153316.sralite	SRA

SRX1566093 SRP069789 RNA-Seq SINGLE

GSM2056820: Ctrl 1hr; Homo sapiens; RNA-Seq

Sample: SRS1280226

BioProject: PRJNA311240

BioSample: SAMN04480963

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: Ctrl 1hr

cell type: NPC

knockdown: ctrl

agent: Actinomycin D

time: 1hr

Original files (1)

Ctrl 1hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153317	9653445	482672250	282.08	NPC1_ctrl.fastq.gz, SRR3153317, SRR3153317.sralite	SRA

SRX1566094 SRP069789 RNA-Seq SINGLE

GSM2056821: FUS KD 1hr; Homo sapiens; RNA-Seq

Sample: SRS1280225

BioProject: PRJNA311240

BioSample: SAMN04480965

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS KD 1hr

cell type: NPC

knockdown: FUS

agent: Actinomycin D

time: 1hr

Original files (1)

FUS KD 1hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153318	8030613	401530650	235.2	NPC1_FUS.fastq.gz, SRR3153318, SRR3153318.sralite	SRA

SRX1566096 SRP069789 RNA-Seq SINGLE

GSM2056822: TAF15 KD 1hr; Homo sapiens; RNA-Seq

Sample: SRS1280223

BioProject: PRJNA311240

BioSample: SAMN04480966

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TAF15 KD 1hr

cell type: NPC

knockdown: TAF15

agent: Actinomycin D

time: 1hr

Original files (1)

TAF15 KD 1hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153319	43974688	2198734400	1310.0	NPC1_TAF15.fastq.gz, SRR3153319, SRR3153319.sralite	SRA

SRX1566097 SRP069789 RNA-Seq SINGLE

GSM2056823: Ctrl 2hr; Homo sapiens; RNA-Seq

Sample: SRS1280222

BioProject: PRJNA311240

BioSample: SAMN04480964

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: Ctrl 2hr

cell type: NPC

knockdown: ctrl

agent: Actinomycin D

time: 2hr

Original files (1)

Ctrl 2hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153320	10360216	518010800	322.85	NPC2_ctrl.fastq.gz, SRR3153320, SRR3153320.sralite	SRA

SRX1566098 SRP069789 RNA-Seq SINGLE

GSM2056824: FUS KD 2hr; Homo sapiens; RNA-Seq

Sample: SRS1280221

BioProject: PRJNA311240

BioSample: SAMN04480967

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS KD 2hr

cell type: NPC

knockdown: FUS

agent: Actinomycin D

time: 2hr

Original files (1)

FUS KD 2hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153321	7976195	398809750	246.11	NPC2_FUS.fastq.gz, SRR3153321, SRR3153321.sralite	SRA

SRX1566099 SRP069789 RNA-Seq SINGLE

GSM2056825: TAF15 KD 2hr; Homo sapiens; RNA-Seq

Sample: SRS1280219

BioProject: PRJNA311240

BioSample: SAMN04480968

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TAF15 KD 2hr

cell type: NPC

knockdown: TAF15

agent: Actinomycin D

time: 2hr

Original files (1)

TAF15 KD 2hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153322	15765989	788299450	485.28	NPC2_TAF15.fastq.gz, SRR3153322, SRR3153322.sralite	SRA

SRX1566100 SRP069789 RNA-Seq SINGLE

GSM2056826: Ctrl 30min; Homo sapiens; RNA-Seq

Sample: SRS1280220

BioProject: PRJNA311240

BioSample: SAMN04480969

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: Ctrl 30min

cell type: NPC

knockdown: ctrl

agent: Actinomycin D

time: 30min

Original files (1)

Ctrl 30min

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153323	14525802	726290100	442.76	NPC30_ctrl.fastq.gz, SRR3153323, SRR3153323.sralite	SRA

SRX1566101 SRP069789 RNA-Seq SINGLE

GSM2056827: FUS KD 30min; Homo sapiens; RNA-Seq

Sample: SRS1280217

BioProject: PRJNA311240

BioSample: SAMN04480970

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS KD 30min

cell type: NPC

knockdown: FUS

agent: Actinomycin D

time: 30min

Original files (1)

FUS KD 30min

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153324	8050632	402531600	251.68	NPC30_FUS.fastq.gz, SRR3153324, SRR3153324.sralite	SRA

SRX1566102 SRP069789 RNA-Seq SINGLE

GSM2056828: TAF15 KD 30min; Homo sapiens; RNA-Seq

Sample: SRS1280218

BioProject: PRJNA311240

BioSample: SAMN04480971

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TAF15 KD 30min

cell type: NPC

knockdown: TAF15

agent: Actinomycin D

time: 30min

Original files (1)

TAF15 KD 30min

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153325	6050699	302534950	181.46	NPC30_TAF15.fastq.gz, SRR3153325, SRR3153325.sralite	SRA

SRX1566103 SRP069789 RNA-Seq SINGLE

GSM2056829: Ctrl 4hr; Homo sapiens; RNA-Seq

Sample: SRS1280216

BioProject: PRJNA311240

BioSample: SAMN04480972

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: Ctrl 4hr

cell type: NPC

knockdown: ctrl

agent: Actinomycin D

time: 4hr

Original files (1)

Ctrl 4hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153326	12480888	624044400	396.26	NPC4_ctrl.fastq.gz, SRR3153326, SRR3153326.sralite	SRA

SRX1566104 SRP069789 RNA-Seq SINGLE

GSM2056830: FUS KD 4hr; Homo sapiens; RNA-Seq

Sample: SRS1280215

BioProject: PRJNA311240

BioSample: SAMN04480973

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS KD 4hr

cell type: NPC

knockdown: FUS

agent: Actinomycin D

time: 4hr

Original files (1)

FUS KD 4hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153327	13108722	655436100	413.65	NPC4_FUS.fastq.gz, SRR3153327, SRR3153327.sralite	SRA

SRX1566105 SRP069789 RNA-Seq SINGLE

GSM2056831: TAF15 KD 4hr; Homo sapiens; RNA-Seq

Sample: SRS1280214

BioProject: PRJNA311240

BioSample: SAMN04480974

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TAF15 KD 4hr

cell type: NPC

knockdown: TAF15

agent: Actinomycin D

time: 4hr

Original files (1)

TAF15 KD 4hr

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153328	7306665	365333250	233.78	NPC4_TAF15.fastq.gz, SRR3153328, SRR3153328.sralite	SRA

Linked Publications (1)

Distinct and shared functions of ALS-associated proteins TDP-43, FUS and TAF15 revealed by multisystem analyses.

Nature communications · 2016

Data Files (36)

Accession	File Name	Stored Type	Size	Download
—	NPC0_ctrl.fastq.gz	RNA-Seq	402.6 MB	link
—	NPC0_ctrl.fastq.gz	RNA-Seq	402.6 MB	link
—	NPC0_FUS.fastq.gz	RNA-Seq	219.4 MB	link
—	NPC0_FUS.fastq.gz	RNA-Seq	219.4 MB	link
—	NPC0_TAF15.fastq.gz	RNA-Seq	66.1 MB	link
—	NPC0_TAF15.fastq.gz	RNA-Seq	66.1 MB	link
—	NPC15_ctrl.fastq.gz	RNA-Seq	1.6 GB	link
—	NPC15_ctrl.fastq.gz	RNA-Seq	1.6 GB	link
—	NPC15_FUS.fastq.gz	RNA-Seq	361.2 MB	link
—	NPC15_FUS.fastq.gz	RNA-Seq	361.2 MB	link
—	NPC15_TAF15.fastq.gz	RNA-Seq	157.1 MB	link
—	NPC15_TAF15.fastq.gz	RNA-Seq	157.1 MB	link
—	NPC1_ctrl.fastq.gz	RNA-Seq	282.1 MB	link
—	NPC1_ctrl.fastq.gz	RNA-Seq	282.1 MB	link
—	NPC1_FUS.fastq.gz	RNA-Seq	235.2 MB	link
—	NPC1_FUS.fastq.gz	RNA-Seq	235.2 MB	link
—	NPC1_TAF15.fastq.gz	RNA-Seq	1.3 GB	link
—	NPC1_TAF15.fastq.gz	RNA-Seq	1.3 GB	link
—	NPC2_ctrl.fastq.gz	RNA-Seq	322.8 MB	link
—	NPC2_ctrl.fastq.gz	RNA-Seq	322.8 MB	link
—	NPC2_FUS.fastq.gz	RNA-Seq	246.1 MB	link
—	NPC2_FUS.fastq.gz	RNA-Seq	246.1 MB	link
—	NPC2_TAF15.fastq.gz	RNA-Seq	485.3 MB	link
—	NPC2_TAF15.fastq.gz	RNA-Seq	485.3 MB	link
—	NPC30_ctrl.fastq.gz	RNA-Seq	442.8 MB	link
—	NPC30_ctrl.fastq.gz	RNA-Seq	442.8 MB	link
—	NPC30_FUS.fastq.gz	RNA-Seq	251.7 MB	link
—	NPC30_FUS.fastq.gz	RNA-Seq	251.7 MB	link
—	NPC30_TAF15.fastq.gz	RNA-Seq	181.5 MB	link
—	NPC30_TAF15.fastq.gz	RNA-Seq	181.5 MB	link
—	NPC4_ctrl.fastq.gz	RNA-Seq	396.3 MB	link
—	NPC4_ctrl.fastq.gz	RNA-Seq	396.3 MB	link
—	NPC4_FUS.fastq.gz	RNA-Seq	413.6 MB	link
—	NPC4_FUS.fastq.gz	RNA-Seq	413.6 MB	link
—	NPC4_TAF15.fastq.gz	RNA-Seq	233.8 MB	link
—	NPC4_TAF15.fastq.gz	RNA-Seq	233.8 MB	link