GSE86043

HNRNPA2B1 regulates alternative RNA processing in the nervous system and accumulates in granules in ALS IPSC-derived motor neurons [hnRNPA2B1_RNA-seq_mouse_SC]

1. Sequencing reads from RNA-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
2. Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
3. Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
4. Reads not mapped to Repbase sequences were aligned to the mm9 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1.
5. Alternative polyadenylation sites were identified from RNA-seq data using the bioinformatics algorithm DaPars (Xia et al., 2014), which uses a regression model to locate endpoints of alternative polyadenylation sites, was used to identify differences in APA events between hnRNP A2/B1 depleted samples and controls.
6. To identify significant APA events, we used the following cutoffs: FDR < 0.05, |ΔPDUI| ≥ 0.2, and |dPDUI| ≥ 0.2.
7. APA scatter plots were generated using the R-Studio program with the ggplot2 library.Â
8. counts of reads for each gene annotated in gencode vM1 were calculated from featureCounts

Supplementary Files (1)

Dataset Citations (1)

Linked Publications (1)