← All datasets

GSE78508

GSE GEO
View on GEO Export SRA CSV

Enhanced CLIP uncovers IMP protein-RNA targets in human pluripotent stem cells important for cell adhesion and survival [RNA-Seq]

Organism: Homo sapiens
Platform: GPL11154
Samples: 5
Experiment Types:
Expression profiling by high throughput sequencing
Submitted: Feb 25 2016
Last Updated: May 15 2019
Status: Public on Apr 07 2016
Contact: Gene,,Yeo (UCSD)

Relations

SubSeries of: GSE78509 BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA313161 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP070819

Summary

Human pluripotent stem cells (hPSCs) require precise control of post-transcriptional RNA networks to maintain proliferation and survival. Using a recently developed enhanced UV crosslinking and immunoprecipitation (eCLIP) approach, we identify RNA targets of the IMP/IGF2BP family of RNA-binding proteins in hPSCs. At the broad region- and binding site-level IMP1 and IMP2 show reproducible binding to a large and overlapping set of 3'UTR-enriched targets. RNA Bind-N-Seq applied to recombinant full-length IMP1 and IMP2 reveals CA-rich motifs that are enriched in eCLIP-defined binding sites. We observe that IMP1 loss in hPSCs recapitulates IMP1 phenotypes, including a reduction in cell adhesion and an increase in cell death. For cell adhesion, in hPSCs we find IMP1 maintains levels of integrin mRNA, specifically regulating RNA stability of ITGB5. Additionally, we show IMP1 can be linked to hPSC survival via direct target BCL2. Thus, transcriptome-wide binding profiles identify hPSC targets modulating well-characterized IMP1 roles.

Overall Design

eCLIP-seq was performed in biological replicate for IGF2BP1/IMP1 and IGF2BP2/IMP2, as well as one replicate each for IGF2BP3/IMP3, RBFOX2, and an IgG control. Each sample has a size-matched input control for analysis

Analysis (5 steps)

View Data Processing
Processing steps for GSE78508
  1. RNA-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
  2. Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
  3. Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
  4. Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1.
  5. counts of reads for each gene annotated in gencode v17 were calculated from featureCounts

Supplementary Files (1)

GSE78508_RAW.tar Download
GEO Samples (5)
GSM2071752 GSM2071753 GSM2071754 GSM2071755 GSM2071756

Dataset Citations (1)

Enhanced CLIP Uncovers IMP Protein-RNA Targets in Human Pluripotent Stem Cells Important for Cell Adhesion and Survival.
PMID 27068461 · 2016 · Cell reports
Anne E Conway, Eric L Van Nostrand, Gabriel A Pratt, Stefan Aigner, Melissa L Wilbert, Balaji Sundararaman, Peter Freese, Nicole J Lambert, Shashank Sathe, Tiffany Y Liang, Anthony Essex, Severine Landais, Christopher B Burge, D Leanne Jones, Gene W Yeo

SRA Experiments (5) and Runs (5)

Total: 6644 MB
SRX1600308 SRP070819 RNA-Seq SINGLE
GSM2071752: H9 ES Control 1; Homo sapiens; RNA-Seq
Sample: SRS1310226
BioProject: PRJNA313161
BioSample: SAMN04516113
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: H9 embryonic stem cell line
shRNA: SHC002
knockdown: control
Original files (1)
H9 embryonic stem cell line
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR3187417 54210262 2710513100 1895.65 ACMW_4_TGACCA_L006_R1.fastq.gz, SRR3187417, SRR3187417.sralite SRA
SRX1600309 SRP070819 RNA-Seq SINGLE
GSM2071753: H9 ES Control 2; Homo sapiens; RNA-Seq
Sample: SRS1310225
BioProject: PRJNA313161
BioSample: SAMN04516114
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: H9 embryonic stem cell line
shRNA: SHC002
knockdown: control
Original files (1)
H9 embryonic stem cell line
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR3187418 25518766 1275938300 893.01 ACMW_5_ACAGTG_L006_R1.fastq.gz, SRR3187418, SRR3187418.sralite SRA
SRX1600310 SRP070819 RNA-Seq SINGLE
GSM2071754: H9 ES IMP1 KD 1; Homo sapiens; RNA-Seq
Sample: SRS1310224
BioProject: PRJNA313161
BioSample: SAMN04516115
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: H9 embryonic stem cell line
shRNA: TRCN0000075149
knockdown: IMP1 knockdown
Original files (1)
H9 embryonic stem cell line
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR3187419 35846578 1792328900 1256.8 ACMW_6_GCCAAT_L006_R1.fastq.gz, SRR3187419, SRR3187419.sralite SRA
SRX1600311 SRP070819 RNA-Seq SINGLE
GSM2071755: H9 ES IMP1 KD 2; Homo sapiens; RNA-Seq
Sample: SRS1310223
BioProject: PRJNA313161
BioSample: SAMN04516116
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: H9 embryonic stem cell line
shRNA: TRCN0000075149
knockdown: IMP1 knockdown
Original files (1)
H9 embryonic stem cell line
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR3187420 37528602 1876430100 1314.91 ACMW_7_CAGATC_L006_R1.fastq.gz, SRR3187420, SRR3187420.sralite SRA
SRX1600312 SRP070819 RNA-Seq SINGLE
GSM2071756: H9 ES IMP1 KD 3; Homo sapiens; RNA-Seq
Sample: SRS1310222
BioProject: PRJNA313161
BioSample: SAMN04516117
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: H9 embryonic stem cell line
shRNA: TRCN0000075149
knockdown: IMP1 knockdown
Original files (1)
H9 embryonic stem cell line
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR3187421 36672029 1833601450 1283.62 ACMW_12_CTTGTA_L006_R1.fastq.gz, SRR3187421, SRR3187421.sralite SRA

Linked Publications (1)

Enhanced CLIP Uncovers IMP Protein-RNA Targets in Human Pluripotent Stem Cells Important for Cell Adhesion and Survival.
Cell reports · 2016

Data Files (10)

Accession File Name Stored Type Output Type Mapping Assembly Size Download
— ACMW_12_CTTGTA_L006_R1.fastq.gz RNA-Seq 1.3 GB link
— ACMW_12_CTTGTA_L006_R1.fastq.gz RNA-Seq 1.3 GB link
— ACMW_4_TGACCA_L006_R1.fastq.gz RNA-Seq 1.9 GB link
— ACMW_4_TGACCA_L006_R1.fastq.gz RNA-Seq 1.9 GB link
— ACMW_5_ACAGTG_L006_R1.fastq.gz RNA-Seq 893.0 MB link
— ACMW_5_ACAGTG_L006_R1.fastq.gz RNA-Seq 893.0 MB link
— ACMW_6_GCCAAT_L006_R1.fastq.gz RNA-Seq 1.2 GB link
— ACMW_6_GCCAAT_L006_R1.fastq.gz RNA-Seq 1.2 GB link
— ACMW_7_CAGATC_L006_R1.fastq.gz RNA-Seq 1.3 GB link
— ACMW_7_CAGATC_L006_R1.fastq.gz RNA-Seq 1.3 GB link