← All datasets

GSE77633

GSE GEO
View on GEO Export SRA CSV

Enhanced CLIP (eCLIP) enables robust and scalable transcriptome-wide discovery and characterization of RNA binding protein binding sites [iCLIP]

Organism: Homo sapiens
Platform: GPL16791
Samples: 1
Experiment Types:
Other
Submitted: Feb 05 2016
Last Updated: May 15 2019
Status: Public on Mar 28 2016
Contact: Gene,,Yeo (UCSD)

Relations

SubSeries of: GSE77634 BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA311059 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP069354

Summary

RNA binding proteins (RBPs) play essential roles in cellular physiology by interacting with target RNAs. As defects in protein-RNA recognition lead to human disease, UV-crosslinking and immunoprecipitation (CLIP) of ribonuclear complexes followed by deep sequencing (-seq) is critical in constructing protein-RNA maps to expand our understanding of RBP function. However, current CLIP protocols are technically demanding and involve low complexity libraries that yield squandered sequencing of PCR duplicates and high experimental failure rates. To enable truly large-scale implementation of CLIP-seq, we have developed an enhanced CLIP methodology (eCLIP) that features a decrease of ~10 cycles of requisite amplification with a concomitant >60% decrease in discarded PCR duplicate reads, while maintaining the ability to identify RNA binding with single-nucleotide resolution. By simplifying the generation of paired IgG and size-matched input controls, eCLIP also dramatically improves specificity in discovery of authentic binding sites. To demonstrate that eCLIP enables large-scale and robust profiling of RBPs, 102 eCLIP experiments in biological duplicate for a diverse collection of 74 RBPs in HepG2 and K562 cells were completed (available at https://www.encodeproject.org). We establish that eCLIP is comparable in amplification and sample requirements to ChIP-seq, and enables integrative analysis of diverse RBPs to reveal factor-specific profiles, common artifacts for CLIP experiments and RNA-centric perspectives of RBP activity.

Overall Design

iCLIP-seq against RBFOX2 in 293T Cells

Analysis (7 steps)

View Data Processing
Processing steps for GSE77633
  1. Sequencing reads from CLIP-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
  2. Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
  3. Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
  4. Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1.
  5. Reads that were PCR replicates were removed from each CLIP-seq library using a custom script.
  6. Briefly one read with a unique barcode was kept at each nucleotide position when more than one with the same barcode was mapped to the same location
  7. Clusters were then assigned using the CLIPper software with parameters --bonferroni --superlocal --threshold- software (Lovci et al., 2013).

Supplementary Files (1)

GSE77633_RAW.tar Download
GEO Samples (1)

Dataset Citations (1)

Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP).
PMID 27018577 · 2016 · Nature methods
Eric L Van Nostrand, Gabriel A Pratt, Alexander A Shishkin, Chelsea Gelboin-Burkhart, Mark Y Fang, Balaji Sundararaman, Steven M Blue, Thai B Nguyen, Christine Surka, Keri Elkins, Rebecca Stanton, Frank Rigo, Mitchell Guttman, Gene W Yeo

SRA Experiments (1) and Runs (4)

Total: 8560 MB
SRX1563234 SRP069354 RIP-Seq SINGLE
GSM2055496: RBFOX2 iCLIP Rep1; Homo sapiens; RIP-Seq
Sample: SRS1277770
BioProject: PRJNA311059
BioSample: SAMN04461220
Platform: ILLUMINA
Instrument: Illumina HiSeq 2500
Organism: Homo sapiens
Sample attributes
source_name: RBFOX2 iCLIP
cell line: 293T
rip antibody: RBFOX2
antibody manufacturer: Abcam
Original files (1)
RBFOX2 iCLIP
Runs (4)
Run Spots Bases Size (MB) Files Link
SRR3147674 21874724 1071861476 691.08 H2_NoIndex_L001_R1.R10_lowRNAse_H_2.randomer.fastq.gz, SRR3147674, SR… SRA
SRR3147675 112120785 5493918465 3443.55 H2_NoIndex_L001_R1.R12_lowRNAse_H_1.randomer.fastq.gz, SRR3147675, SR… SRA
SRR3147676 22648473 1109775177 696.56 M2_NoIndex_L002_R1.R10_lowRNAse_M_2.randomer.fastq.gz, SRR3147676, SR… SRA
SRR3147677 124320492 6091704108 3728.54 M2_NoIndex_L002_R1.R12_lowRNAse_M_1.randomer.fastq.gz, SRR3147677, SR… SRA

Linked Publications (1)

Data Files (8)

Accession File Name Stored Type Output Type Mapping Assembly Size Download
H2_NoIndex_L001_R1.R10_lowRNAse_H_2.randomer.fastq.gz RIP-Seq 691.1 MB link
H2_NoIndex_L001_R1.R10_lowRNAse_H_2.randomer.fastq.gz RIP-Seq 691.1 MB link
H2_NoIndex_L001_R1.R12_lowRNAse_H_1.randomer.fastq.gz RIP-Seq 3.4 GB link
H2_NoIndex_L001_R1.R12_lowRNAse_H_1.randomer.fastq.gz RIP-Seq 3.4 GB link
M2_NoIndex_L002_R1.R10_lowRNAse_M_2.randomer.fastq.gz RIP-Seq 696.6 MB link
M2_NoIndex_L002_R1.R10_lowRNAse_M_2.randomer.fastq.gz RIP-Seq 696.6 MB link
M2_NoIndex_L002_R1.R12_lowRNAse_M_1.randomer.fastq.gz RIP-Seq 3.6 GB link
M2_NoIndex_L002_R1.R12_lowRNAse_M_1.randomer.fastq.gz RIP-Seq 3.6 GB link