GSE86041
GSE GEOHNRNPA2B1 regulates alternative RNA processing in the nervous system and accumulates in granules in ALS IPSC-derived motor neurons [iCLIP-seq]
Relations
Summary
HnRNPA2B1 encodes an RNA binding protein associated with neurodegenerative disorders. However, its function in the nervous system is unclear. Transcriptome-wide cross-linking and immunoprecipitation in mouse spinal cord discover UAGG motifs enriched within ~2,500 hnRNP A2/B1 binding sites and an unexpected role for hnRNP A2/B1 in alternative polyadenylation. Loss of hnRNP A2/B1 results in alternative splicing, including skipping of an exon in amyotrophic lateral sclerosis (ALS)-associated D-amino acid oxidase (DAO) that reduces D-serine metabolism. Inclusion of the DAO exon is also reduced in transgenic ALS mice models. ALS-associated hnRNP A2/B1 D290V mutant patient fibroblasts and motor neurons differentiated from induced pluripotent stem cells demonstrate gain-of-mutant-dependent splicing differences. Mutant motor neurons also exhibit increased hnRNP A2/B1 localization to cytoplasmic granules during stress, which are abrogated by a small molecule CA43. Our findings and cellular resource identify RNA networks affected in loss of normal and mutated hnRNP A2/B1 with broad relevance to neurodegeneration.
Overall Design
iCLIP-seq in mouse spinal cord for hnRNP A2/B1. one replicate
Analysis (7 steps)
View Data Processing- Raw CLIP-seq reads were trimmed of polyA tails, adapters and low quality ends using Cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
- Trimmed reads were mapped against a database of repetitive elements derived from RepBase (version 18.05) using Bowtie (version 1.0.0) with parameters -S -q -p 16 -e 100 -l 20 (Langmead et al.
- 2009).
- Reads not mapped to repetitive elements were mapped to the mm9 mouse genome (UCSC assembly) using STAR (version 2.3.03) with parameters --outSAMunmapped Within âoutFilterMultimapNmax 1 âoutFilterMultimapScoreRange 1 (Dobin et al.
- 2013).
- Reads having the same 5â mapping position were collapsed to a single read to eliminate PCR duplication.
- CLIP-seq peaks were identified as previously described (Zisoulis et al, NSMB 2010).
Supplementary Files (1)
GEO Samples (1)
Dataset Citations (1)
SRA Experiments (1) and Runs (1)
Total: 2265 MBSample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR4175327 | 69915012 | 3495750600 | 2264.95 | 2_NoIndex_L002_R1.R16.randomer.fastq.gz, SRR4175327, SRR4175327.srali… | SRA |