← All datasets

GSE69585

GSE GEO
View on GEO Export SRA CSV

Target discrimination in nonsense-mediated mRNA decay requires Upf1 ATPase activity (RIP-Seq)

Organism: Homo sapiens
Platform: GPL11154
Samples: 8
Experiment Types:
Other
Submitted: Jun 04 2015
Last Updated: May 15 2019
Status: Public on Jul 06 2015
Contact: Gene,,Yeo (UCSD)

Relations

SubSeries of: GSE69586 BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA285903 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP059080

Summary

RNA quality control pathways serve to get rid of faulty RNAs and therefore must be able to discriminate these RNAs from those that are normal. Here we present evidence that the ATPase cycle of SF1 Helicase Upf1 is required for mRNA discrimination during Nonsense-Mediated Decay (NMD). Mutations affecting the Upf1 ATPase cycle disrupt the mRNA selectivity of Upf1, leading to indiscriminate accumulation of NMD complexes on both NMD target and non-target mRNAs. In addition, two modulators of NMD - translation and termination codon-proximal poly(A) binding protein - depend on Upf1 ATPase to limit Upf1-non-target association. Preferential ATPase-dependent dissociation of Upf1 from non-target mRNAs in vitro suggests that selective release of Upf1 contributes to the ATPase-dependence of Upf1 target discrimination. Given the prevalence of helicases in RNA regulation, ATP hydrolysis may be an underappreciated, yet widely employed, activity in target RNA discrimination.

Overall Design

CLIP and RIP-seq against Wild Type and Mutant Upf1 in HEK293-T cell lines

Analysis (5 steps)

View Data Processing
Processing steps for GSE69585
  1. Sequencing reads from CLIP-seq and RIP-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
  2. Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
  3. Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
  4. Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1.
  5. RPKMs for each gene annotated in gencode v17 were calculated from RIP-seq data using custom scripts

Supplementary Files (1)

GSE69585_RAW.tar Download
GEO Samples (8)
GSM1704220 GSM1704221 GSM1704222 GSM1704223 GSM1704224 GSM1704225 GSM1704226 GSM1704227

Dataset Citations (1)

Target Discrimination in Nonsense-Mediated mRNA Decay Requires Upf1 ATPase Activity.
PMID 26253027 · 2015 · Molecular cell
Suzanne R Lee, Gabriel A Pratt, Fernando J Martinez, Gene W Yeo, Jens Lykke-Andersen

SRA Experiments (8) and Runs (8)

Total: 12250 MB
SRX1048855 SRP059080 RIP-Seq SINGLE
GSM1704220: DEAA Input; Homo sapiens; RIP-Seq
Sample: SRS953180
BioProject: PRJNA285903
BioSample: SAMN03761804
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: FLP-in 293 cells
cell line: HEK 293 FRT
antibody: Anti-FLAG IP RNA
Original files (1)
FLP-in 293 cells
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051427 26906207 2690620700 1781.47 D-in_AGCGATAG-TATAGCCT_L001_R1.fastq.gz, SRR2051427, SRR2051427.srali… SRA
SRX1048856 SRP059080 RIP-Seq SINGLE
GSM1704221: DEAA IP; Homo sapiens; RIP-Seq
Sample: SRS953179
BioProject: PRJNA285903
BioSample: SAMN03761805
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: FLP-in 293 cells
cell line: HEK 293 FRT
antibody: Anti-FLAG IP RNA
Original files (1)
FLP-in 293 cells
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051428 83108174 8310817400 5400.7 D-IP_ATTACTCG-ATAGAGGC_L001_R1.fastq.gz, SRR2051428, SRR2051428.srali… SRA
SRX1048857 SRP059080 RIP-Seq SINGLE
GSM1704222: Flag Input; Homo sapiens; RIP-Seq
Sample: SRS953178
BioProject: PRJNA285903
BioSample: SAMN03761806
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: FLP-in 293 cells
cell line: HEK 293 FRT
antibody: Anti-FLAG IP RNA
Original files (1)
FLP-in 293 cells
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051429 7492719 749271900 497.71 F-in_TAATGCGC-TATAGCCT_L004_R1.fastq.gz, SRR2051429, SRR2051429.srali… SRA
SRX1048858 SRP059080 RIP-Seq SINGLE
GSM1704223: Flag IP; Homo sapiens; RIP-Seq
Sample: SRS953177
BioProject: PRJNA285903
BioSample: SAMN03761807
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: FLP-in 293 cells
cell line: HEK 293 FRT
antibody: Anti-FLAG IP RNA
Original files (1)
FLP-in 293 cells
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051430 4736306 473630600 317.5 F-IP_CGGCTATG-TATAGCCT_L007_R1.fastq.gz, SRR2051430, SRR2051430.srali… SRA
SRX1048859 SRP059080 RIP-Seq SINGLE
GSM1704224: K498A Input; Homo sapiens; RIP-Seq
Sample: SRS953176
BioProject: PRJNA285903
BioSample: SAMN03761808
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: FLP-in 293 cells
cell line: HEK 293 FRT
antibody: Anti-FLAG IP RNA
Original files (1)
FLP-in 293 cells
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051431 24430858 2443085800 1611.17 K-in_TCCGGAGA-ATAGAGGC_L001_R1.fastq.gz, SRR2051431, SRR2051431.srali… SRA
SRX1048860 SRP059080 RIP-Seq SINGLE
GSM1704225: K498A IP; Homo sapiens; RIP-Seq
Sample: SRS953175
BioProject: PRJNA285903
BioSample: SAMN03761809
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: FLP-in 293 cells
cell line: HEK 293 FRT
antibody: Anti-FLAG IP RNA
Original files (1)
FLP-in 293 cells
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051432 15685043 1568504300 1028.16 K-IP_CGCTCATT-ATAGAGGC_L001_R1.fastq.gz, SRR2051432, SRR2051432.srali… SRA
SRX1048861 SRP059080 RIP-Seq SINGLE
GSM1704226: WT Input; Homo sapiens; RIP-Seq
Sample: SRS953174
BioProject: PRJNA285903
BioSample: SAMN03761810
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: FLP-in 293 cells
cell line: HEK 293 FRT
antibody: Anti-FLAG IP RNA
Original files (1)
FLP-in 293 cells
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051433 16689843 1668984300 1105.2 W-in_TCCGCGAA-TATAGCCT.fastq.gz, SRR2051433, SRR2051433.sralite SRA
SRX1048862 SRP059080 RIP-Seq SINGLE
GSM1704227: WT IP; Homo sapiens; RIP-Seq
Sample: SRS953173
BioProject: PRJNA285903
BioSample: SAMN03761811
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Homo sapiens
Sample attributes
source_name: FLP-in 293 cells
cell line: HEK 293 FRT
antibody: Anti-FLAG IP RNA
Original files (1)
FLP-in 293 cells
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR2051434 7626058 762605800 508.13 W-IP_TCTCGCGC-TATAGCCT_L001_R1.fastq.gz, SRR2051434, SRR2051434.srali… SRA

Linked Publications (1)

Target Discrimination in Nonsense-Mediated mRNA Decay Requires Upf1 ATPase Activity.
Molecular cell · 2015

Data Files (12)

Accession File Name Stored Type Output Type Mapping Assembly Size Download
— D-in_AGCGATAG-TATAGCCT_L001_R1.fastq.gz RIP-Seq 1.7 GB link
— D-IP_ATTACTCG-ATAGAGGC_L001_R1.fastq.gz RIP-Seq 5.3 GB link
— F-in_TAATGCGC-TATAGCCT_L004_R1.fastq.gz RIP-Seq 497.7 MB link
— F-IP_CGGCTATG-TATAGCCT_L007_R1.fastq.gz RIP-Seq 317.5 MB link
— K-in_TCCGGAGA-ATAGAGGC_L001_R1.fastq.gz RIP-Seq 1.6 GB link
— K-IP_CGCTCATT-ATAGAGGC_L001_R1.fastq.gz RIP-Seq 1.0 GB link
— SRR2051427 RIP-Seq 1.7 GB link
— SRR2051432 RIP-Seq 1.0 GB link
— SRR2051433 RIP-Seq 1.1 GB link
— SRR2051434 RIP-Seq 508.1 MB link
— W-in_TCCGCGAA-TATAGCCT.fastq.gz RIP-Seq 1.1 GB link
— W-IP_TCTCGCGC-TATAGCCT_L001_R1.fastq.gz RIP-Seq 508.1 MB link