GSE69585
GSE GEOTarget discrimination in nonsense-mediated mRNA decay requires Upf1 ATPase activity (RIP-Seq)
Relations
Summary
RNA quality control pathways serve to get rid of faulty RNAs and therefore must be able to discriminate these RNAs from those that are normal. Here we present evidence that the ATPase cycle of SF1 Helicase Upf1 is required for mRNA discrimination during Nonsense-Mediated Decay (NMD). Mutations affecting the Upf1 ATPase cycle disrupt the mRNA selectivity of Upf1, leading to indiscriminate accumulation of NMD complexes on both NMD target and non-target mRNAs. In addition, two modulators of NMD - translation and termination codon-proximal poly(A) binding protein - depend on Upf1 ATPase to limit Upf1-non-target association. Preferential ATPase-dependent dissociation of Upf1 from non-target mRNAs in vitro suggests that selective release of Upf1 contributes to the ATPase-dependence of Upf1 target discrimination. Given the prevalence of helicases in RNA regulation, ATP hydrolysis may be an underappreciated, yet widely employed, activity in target RNA discrimination.
Overall Design
CLIP and RIP-seq against Wild Type and Mutant Upf1 in HEK293-T cell lines
Analysis (5 steps)
View Data Processing- Sequencing reads from CLIP-seq and RIP-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
- Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
- Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
- Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within âoutFilterMultimapNmax 1 âoutFilterMultimapScoreRange 1.
- RPKMs for each gene annotated in gencode v17 were calculated from RIP-seq data using custom scripts
Supplementary Files (1)
GEO Samples (8)
Dataset Citations (1)
SRA Experiments (8) and Runs (8)
Total: 12250 MBSample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051427 | 26906207 | 2690620700 | 1781.47 | D-in_AGCGATAG-TATAGCCT_L001_R1.fastq.gz, SRR2051427, SRR2051427.srali… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051428 | 83108174 | 8310817400 | 5400.7 | D-IP_ATTACTCG-ATAGAGGC_L001_R1.fastq.gz, SRR2051428, SRR2051428.srali… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051429 | 7492719 | 749271900 | 497.71 | F-in_TAATGCGC-TATAGCCT_L004_R1.fastq.gz, SRR2051429, SRR2051429.srali… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051430 | 4736306 | 473630600 | 317.5 | F-IP_CGGCTATG-TATAGCCT_L007_R1.fastq.gz, SRR2051430, SRR2051430.srali… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051431 | 24430858 | 2443085800 | 1611.17 | K-in_TCCGGAGA-ATAGAGGC_L001_R1.fastq.gz, SRR2051431, SRR2051431.srali… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051432 | 15685043 | 1568504300 | 1028.16 | K-IP_CGCTCATT-ATAGAGGC_L001_R1.fastq.gz, SRR2051432, SRR2051432.srali… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051433 | 16689843 | 1668984300 | 1105.2 | W-in_TCCGCGAA-TATAGCCT.fastq.gz, SRR2051433, SRR2051433.sralite | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR2051434 | 7626058 | 762605800 | 508.13 | W-IP_TCTCGCGC-TATAGCCT_L001_R1.fastq.gz, SRR2051434, SRR2051434.srali… | SRA |
Linked Publications (1)
Data Files (12)
| Accession | File Name | Stored Type | Output Type | Mapping Assembly | Size | Download | |
|---|---|---|---|---|---|---|---|
| — | D-in_AGCGATAG-TATAGCCT_L001_R1.fastq.gz | RIP-Seq | 1.7 GB | link | |||
| — | D-IP_ATTACTCG-ATAGAGGC_L001_R1.fastq.gz | RIP-Seq | 5.3 GB | link | |||
| — | F-in_TAATGCGC-TATAGCCT_L004_R1.fastq.gz | RIP-Seq | 497.7 MB | link | |||
| — | F-IP_CGGCTATG-TATAGCCT_L007_R1.fastq.gz | RIP-Seq | 317.5 MB | link | |||
| — | K-in_TCCGGAGA-ATAGAGGC_L001_R1.fastq.gz | RIP-Seq | 1.6 GB | link | |||
| — | K-IP_CGCTCATT-ATAGAGGC_L001_R1.fastq.gz | RIP-Seq | 1.0 GB | link | |||
| — | SRR2051427 | RIP-Seq | 1.7 GB | link | |||
| — | SRR2051432 | RIP-Seq | 1.0 GB | link | |||
| — | SRR2051433 | RIP-Seq | 1.1 GB | link | |||
| — | SRR2051434 | RIP-Seq | 508.1 MB | link | |||
| — | W-in_TCCGCGAA-TATAGCCT.fastq.gz | RIP-Seq | 1.1 GB | link | |||
| — | W-IP_TCTCGCGC-TATAGCCT_L001_R1.fastq.gz | RIP-Seq | 508.1 MB | link |