GSE77702

GSE GEO

View on GEO Export SRA CSV

Distinct and shared functions of ALS-associated TDP-43, FUS, and TAF15 revealed by comprehensive multi-system integrative analyses [RNA-Seq_human]

Organism: Homo sapiens

Platform: GPL11154

Samples: 16

Experiment Types:

Expression profiling by high throughput sequencing

Submitted: Feb 08 2016

Last Updated: May 15 2019

Status: Public on Jul 05 2016

Contact: Gene,,Yeo (UCSD)

Relations

SubSeries of: GSE77707 BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA311234 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP069787

Summary

TDP-43, FUS, and TAF15 are implicated in amyotrophic lateral sclerosis (ALS) and frontotemporal dementia. We integrate CLIP-seq and RNA Bind-N-Seq technologies to discover that TAF15 binds to ~4,900 RNAs enriched for GGUA motifs. In the mouse brain, TAF15 and FUS, but not TDP-43, exhibit strikingly similar RNA binding profiles, yet they alter the expression of distinct mRNA populations upon their individual depletions. TAF15 has a minimal role in alternative splicing and instead affects RNA turnover, consistent with an enrichment of TAF15 binding sites in 3â untranslated regions. In human stem cell-derived motor neurons, loss of both TAF15 and FUS affected mRNAs distinct from those altered by loss of either protein alone, revealing redundant roles for TAF15 and FUS in maintaining mRNA levels. Furthermore, concomitant rather than individual depletion of TAF15 and FUS more closely resembles RNA profiles of motor neurons derived from FUS R521G ALS patients or from late-stage, sporadic ALS patients. Our study reveals convergent and divergent mechanisms by which FUS, TAF15 and TDP-43 affects RNA metabolism in neurological disease.

Overall Design

RNA-seq, CLIP-seq and arrays in mouse and human against TAF15 knockdowns This Series represents RNA-seq sample(s).

Analysis (5 steps)

View Data Processing

Processing steps for GSE77702

RNA-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within âoutFilterMultimapNmax 1 âoutFilterMultimapScoreRange 1.
counts of reads for each gene annotated in gencode v17 were calculated from featureCounts

Supplementary Files (1)

GSE77702_RAW.tar Download

GEO Samples (16)

GSM2056794 GSM2056795 GSM2056796 GSM2056797 GSM2056798 GSM2056799 GSM2056800 GSM2056801 GSM2056802 GSM2056803 GSM2056804 GSM2056805 GSM2056806 GSM2056807 GSM2056808 GSM2056809

Dataset Citations (1)

Distinct and shared functions of ALS-associated proteins TDP-43, FUS and TAF15 revealed by multisystem analyses.

PMID 27378374 · 2016 · Nature communications

Katannya Kapeli, Gabriel A Pratt, Anthony Q Vu, Kasey R Hutt, Fernando J Martinez, Balaji Sundararaman, Ranjan Batra, Peter Freese, Nicole J Lambert, Stephanie C Huelga, Seung J Chun, Tiffany Y Liang, Jeremy Chang, John P Donohue, Lily Shiue, Jiayu Zhang, Haining Zhu, Franca Cambi, Edward Kasarskis, Shawn Hoon, Manuel Ares, Christopher B Burge, John Ravits, Frank Rigo, Gene W Yeo

SRA Experiments (16) and Runs (16)

Total: 31432 MB

SRX1566047 SRP069787 RNA-Seq SINGLE

GSM2056794: FUS Knockdown Rep1; Homo sapiens; RNA-Seq

Sample: SRS1280190

BioProject: PRJNA311234

BioSample: SAMN04480830

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS Knockdown

cell type: Motor Neuron

shRNA: FUS

genotype/variation: FUS Knockdown

Original files (1)

FUS Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153251	48334790	4833479000	3266.28	FUS_shRNA_1.fastq.gz, SRR3153251, SRR3153251.sralite	SRA

SRX1566048 SRP069787 RNA-Seq SINGLE

GSM2056795: FUS Knockdown Rep2; Homo sapiens; RNA-Seq

Sample: SRS1280398

BioProject: PRJNA311234

BioSample: SAMN04480831

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS Knockdown

cell type: Motor Neuron

shRNA: FUS

genotype/variation: FUS Knockdown

Original files (1)

FUS Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153252	46737651	4673765100	3156.16	FUS_shRNA_2.fastq.gz, SRR3153252, SRR3153252.sralite	SRA

SRX1566049 SRP069787 RNA-Seq SINGLE

GSM2056796: FUS and TAF15 Knockdown Rep1; Homo sapiens; RNA-Seq

Sample: SRS1280189

BioProject: PRJNA311234

BioSample: SAMN04480832

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS and TAF15 Knockdown

cell type: Motor Neuron

shRNA: FUS and TAF15

genotype/variation: FUS and TAF15 Knockdown

Original files (1)

FUS and TAF15 Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153253	48453046	4845304600	3294.99	FUS_TAF15_shRNA_1.fastq.gz, SRR3153253, SRR3153253.sralite	SRA

SRX1566050 SRP069787 RNA-Seq SINGLE

GSM2056797: FUS and TAF15 Knockdown Rep2; Homo sapiens; RNA-Seq

Sample: SRS1280188

BioProject: PRJNA311234

BioSample: SAMN04480833

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS and TAF15 Knockdown

cell type: Motor Neuron

shRNA: FUS and TAF15

genotype/variation: FUS and TAF15 Knockdown

Original files (1)

FUS and TAF15 Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153254	42856351	4285635100	2887.15	FUS_TAF15_shRNA_2.fastq.gz, SRR3153254, SRR3153254.sralite	SRA

SRX1566051 SRP069787 RNA-Seq SINGLE

GSM2056798: Scramble Knockdown Rep1; Homo sapiens; RNA-Seq

Sample: SRS1280187

BioProject: PRJNA311234

BioSample: SAMN04480834

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: Scramble Knockdown

cell type: Motor Neuron

shRNA: Scramble

genotype/variation: Scramble Knockdown

Original files (1)

Scramble Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153255	22513222	2251322200	1522.12	Scrm_1.fastq.gz, SRR3153255, SRR3153255.sralite	SRA

SRX1566052 SRP069787 RNA-Seq SINGLE

GSM2056799: Scramble Knockdown Rep2; Homo sapiens; RNA-Seq

Sample: SRS1280185

BioProject: PRJNA311234

BioSample: SAMN04480835

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: Scramble Knockdown

cell type: Motor Neuron

shRNA: Scramble

genotype/variation: Scramble Knockdown

Original files (1)

Scramble Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153256	33675077	3367507700	2279.68	Scrm_2.fastq.gz, SRR3153256, SRR3153256.sralite	SRA

SRX1566053 SRP069787 RNA-Seq SINGLE

GSM2056800: TAF15 Knockdown Rep1; Homo sapiens; RNA-Seq

Sample: SRS1280186

BioProject: PRJNA311234

BioSample: SAMN04480836

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TAF15 Knockdown

cell type: Motor Neuron

shRNA: TAF15

genotype/variation: TAF15 Knockdown

Original files (1)

TAF15 Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153257	47587547	4758754700	3137.24	TAF15_shRNA_1.fastq.gz, SRR3153257, SRR3153257.sralite	SRA

SRX1566054 SRP069787 RNA-Seq SINGLE

GSM2056801: TAF15 Knockdown Rep2; Homo sapiens; RNA-Seq

Sample: SRS1280184

BioProject: PRJNA311234

BioSample: SAMN04480837

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TAF15 Knockdown

cell type: Motor Neuron

shRNA: TAF15

genotype/variation: TAF15 Knockdown

Original files (1)

TAF15 Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153258	39768330	3976833000	2625.81	TAF15_shRNA_2.fastq.gz, SRR3153258, SRR3153258.sralite	SRA

SRX1566055 SRP069787 RNA-Seq SINGLE

GSM2056802: TDP43 Knockdown Rep1; Homo sapiens; RNA-Seq

Sample: SRS1280183

BioProject: PRJNA311234

BioSample: SAMN04480838

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TDP43 Knockdown

cell type: Motor Neuron

shRNA: TDP43

genotype/variation: TDP43 Knockdown

Original files (1)

TDP43 Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153259	44386427	4438642700	2934.08	TDP43_shRNA_1.fastq.gz, SRR3153259, SRR3153259.sralite	SRA

SRX1566056 SRP069787 RNA-Seq SINGLE

GSM2056803: TDP43 Knockdown Rep2; Homo sapiens; RNA-Seq

Sample: SRS1280182

BioProject: PRJNA311234

BioSample: SAMN04480839

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: TDP43 Knockdown

cell type: Motor Neuron

shRNA: TDP43

genotype/variation: TDP43 Knockdown

Original files (1)

TDP43 Knockdown

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153260	29905668	2990566800	1984.58	TDP43_shRNA_2.fastq.gz, SRR3153260, SRR3153260.sralite	SRA

SRX1566057 SRP069787 RNA-Seq SINGLE

GSM2056804: FUS R521G Rep 1; Homo sapiens; RNA-Seq

Sample: SRS1280181

BioProject: PRJNA311234

BioSample: SAMN04480840

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS R521G

cell type: Motor Neuron

genotype/variation: FUS R521G

Original files (1)

FUS R521G

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153261	11700261	585013050	395.49	AV_GY6_2_1_CTGAAGC_L001_R1.fastq.gz, SRR3153261, SRR3153261.sralite	SRA

SRX1566058 SRP069787 RNA-Seq SINGLE

GSM2056805: FUS R521G Rep 2; Homo sapiens; RNA-Seq

Sample: SRS1280180

BioProject: PRJNA311234

BioSample: SAMN04480841

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS R521G

cell type: Motor Neuron

genotype/variation: FUS R521G

Original files (1)

FUS R521G

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153262	20679998	1033999900	697.74	AV_GY7_3_1_CGGCTAT_L001_R1.fastq.gz, SRR3153262, SRR3153262.sralite	SRA

SRX1566059 SRP069787 RNA-Seq SINGLE

GSM2056806: FUS R521G Rep 3; Homo sapiens; RNA-Seq

Sample: SRS1280179

BioProject: PRJNA311234

BioSample: SAMN04480842

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: FUS R521G

cell type: Motor Neuron

genotype/variation: FUS R521G

Original files (1)

FUS R521G

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153263	30072605	1503630250	1011.33	AV_GY7_6_1_TCCGGAG_L005_R1.fastq.gz, SRR3153263, SRR3153263.sralite	SRA

SRX1566060 SRP069787 RNA-Seq SINGLE

GSM2056807: WT Sibling Control Rep 1; Homo sapiens; RNA-Seq

Sample: SRS1280178

BioProject: PRJNA311234

BioSample: SAMN04480843

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: WT Sibling Control

cell type: Motor Neuron

genotype/variation: WT

Original files (1)

WT Sibling Control

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153264	20572507	1028625350	737.84	AV_KIN1ALS17_3_1_TAATGCG_L002_R1.fastq.gz, SRR3153264, SRR3153264.sra…	SRA

SRX1566061 SRP069787 RNA-Seq SINGLE

GSM2056808: WT Sibling Control Rep 2; Homo sapiens; RNA-Seq

Sample: SRS1280177

BioProject: PRJNA311234

BioSample: SAMN04480844

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: WT Sibling Control

cell type: Motor Neuron

genotype/variation: WT

Original files (1)

WT Sibling Control

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153265	30857936	1542896800	1046.73	AV_KIN1ALS6_4_1_TCCGCGA_L003_R1.fastq.gz, SRR3153265, SRR3153265.sral…	SRA

SRX1566062 SRP069787 RNA-Seq SINGLE

GSM2056809: WT Sibling Control Rep 2 scramble shRNA treated; Homo sapiens; RNA-Seq

Sample: SRS1280176

BioProject: PRJNA311234

BioSample: SAMN04480845

Platform: ILLUMINA

Instrument: Illumina HiSeq 2000

Organism: Homo sapiens

Sample attributes

source_name: WT Sibling Control, scramble shRNA treated

cell type: Motor Neuron

shRNA: scramble

genotype/variation: WT

Original files (1)

WT Sibling Control, scramble shRNA treated

Runs (1)

Run	Spots	Bases	Size (MB)	Files	Link
SRR3153266	13283861	664193050	455.05	AV_KIN1ALS6_4_shSCR_1_CTGAAGC_L004_R1.fastq.gz, SRR3153266, SRR315326…	SRA

Linked Publications (1)

Distinct and shared functions of ALS-associated proteins TDP-43, FUS and TAF15 revealed by multisystem analyses.

Nature communications · 2016

Data Files (32)

Accession	File Name	Stored Type	Size	Download
—	AV_GY6_2_1_CTGAAGC_L001_R1.fastq.gz	RNA-Seq	395.5 MB	link
—	AV_GY6_2_1_CTGAAGC_L001_R1.fastq.gz	RNA-Seq	395.5 MB	link
—	AV_GY7_3_1_CGGCTAT_L001_R1.fastq.gz	RNA-Seq	697.7 MB	link
—	AV_GY7_3_1_CGGCTAT_L001_R1.fastq.gz	RNA-Seq	697.7 MB	link
—	AV_GY7_6_1_TCCGGAG_L005_R1.fastq.gz	RNA-Seq	1011.3 MB	link
—	AV_GY7_6_1_TCCGGAG_L005_R1.fastq.gz	RNA-Seq	1011.3 MB	link
—	AV_KIN1ALS17_3_1_TAATGCG_L002_R1.fastq.gz	RNA-Seq	737.8 MB	link
—	AV_KIN1ALS17_3_1_TAATGCG_L002_R1.fastq.gz	RNA-Seq	737.8 MB	link
—	AV_KIN1ALS6_4_1_TCCGCGA_L003_R1.fastq.gz	RNA-Seq	1.0 GB	link
—	AV_KIN1ALS6_4_1_TCCGCGA_L003_R1.fastq.gz	RNA-Seq	1.0 GB	link
—	AV_KIN1ALS6_4_shSCR_1_CTGAAGC_L004_R1.fastq.gz	RNA-Seq	455.0 MB	link
—	AV_KIN1ALS6_4_shSCR_1_CTGAAGC_L004_R1.fastq.gz	RNA-Seq	455.0 MB	link
—	FUS_shRNA_1.fastq.gz	RNA-Seq	3.2 GB	link
—	FUS_shRNA_1.fastq.gz	RNA-Seq	3.2 GB	link
—	FUS_shRNA_2.fastq.gz	RNA-Seq	3.1 GB	link
—	FUS_shRNA_2.fastq.gz	RNA-Seq	3.1 GB	link
—	FUS_TAF15_shRNA_1.fastq.gz	RNA-Seq	3.2 GB	link
—	FUS_TAF15_shRNA_1.fastq.gz	RNA-Seq	3.2 GB	link
—	FUS_TAF15_shRNA_2.fastq.gz	RNA-Seq	2.8 GB	link
—	FUS_TAF15_shRNA_2.fastq.gz	RNA-Seq	2.8 GB	link
—	Scrm_1.fastq.gz	RNA-Seq	1.5 GB	link
—	Scrm_1.fastq.gz	RNA-Seq	1.5 GB	link
—	Scrm_2.fastq.gz	RNA-Seq	2.2 GB	link
—	Scrm_2.fastq.gz	RNA-Seq	2.2 GB	link
—	TAF15_shRNA_1.fastq.gz	RNA-Seq	3.1 GB	link
—	TAF15_shRNA_1.fastq.gz	RNA-Seq	3.1 GB	link
—	TAF15_shRNA_2.fastq.gz	RNA-Seq	2.6 GB	link
—	TAF15_shRNA_2.fastq.gz	RNA-Seq	2.6 GB	link
—	TDP43_shRNA_1.fastq.gz	RNA-Seq	2.9 GB	link
—	TDP43_shRNA_1.fastq.gz	RNA-Seq	2.9 GB	link
—	TDP43_shRNA_2.fastq.gz	RNA-Seq	1.9 GB	link
—	TDP43_shRNA_2.fastq.gz	RNA-Seq	1.9 GB	link