← All datasets

GSE51685

GSE GEO
View on GEO Export SRA CSV

Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for amyotrophic lateral sclerosis and frontotemporal dementia (strand specific RNA-seq)

Organism: Mus musculus
Platform: GPL13112
Samples: 9
Experiment Types:
Expression profiling by high throughput sequencing
Submitted: Oct 24 2013
Last Updated: May 15 2019
Status: Public on Nov 12 2013
Contact: John,,Ravits (UCSD)

Relations

SubSeries of: GSE51741 BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA224741 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP032164

Summary

Purpose: The purpose of this experiment is to identify expression changes after ASO-dependent depletion of mouse C9orf72 in the spinal cord of wild-type C57Bl/6 female mice. Methods: Strand specific RNA-seq was performed using RNAs extracted from spinal cord of C57Bl/6 mice two weeks after intracerebroventricular stereotactic injection of saline (n=3), a control ASO (n=3) or an ASO targeting mouse C9orf72 (n=3). C9orf72 RNA levels were reduced to approximately 30% of control levels in spinal cords from mice treated with the C9orf72 ASO. Results: Statistical comparison of RPKM values between RNAs from C9orf72 and control ASO treated animals or C9orf72 and saline treated samples revealed that only 12 genes were consistently upregulated (defined by P<0.05 adjusted for multiple testing) and 12 genes including C9orf72 were downregulated (defined by P<0.05 adjusted for multiple testing). Conclusions: Only few RNA expression changes were identified in the spinal cord following reduction of C9orf72.

Overall Design

Use of strand specific RNA-seq to test the consequences of C9orf72 loss of function in mouse spinal cord.

Analysis (6 steps)

View Data Processing
Processing steps for GSE51685
  1. Illumina Casava1.8.2 software used for basecalling.
  2. Adapters trimmed using Cutadapt v1.2.1.
  3. Command: cutadapt -O 5 -a GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
  4. Trimmed reads mapped to mouse genome (mm9) using the GSNAP aligner (part of GMAP package, version 2012-07-20).
  5. Command: gsnap -Q -n 10 Â --quality-protocol="sanger" -t 4 -N 1 -A sam -B 5 -s mm9 -d mm9
  6. Mapped reads assigned to coding regions of Ensembl mouse genes

Supplementary Files (1)

GSE51685_SC_c9_table.txt.gz Download
GEO Samples (9)
GSM1251885 GSM1251886 GSM1251887 GSM1251888 GSM1251889 GSM1251890 GSM1251891 GSM1251892 GSM1251893

Dataset Citations (1)

Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration.
PMID 24170860 · 2013 · Proceedings of the National Academy of Sciences of the United States of America
Clotilde Lagier-Tourenne, Michael Baughn, Frank Rigo, Shuying Sun, Patrick Liu, Hai-Ri Li, Jie Jiang, Andrew T Watt, Seung Chun, Melanie Katz, Jinsong Qiu, Ying Sun, Shuo-Chien Ling, Qiang Zhu, Magdalini Polymenidou, Kevin Drenner, Jonathan W Artates, Melissa McAlonis-Downes, Sebastian Markmiller, Kasey R Hutt, Donald P Pizzo, Janet Cady, Matthew B Harms, Robert H Baloh, Scott R Vandenberg, Gene W Yeo, Xiang-Dong Fu, C Frank Bennett, Don W Cleveland, John Ravits

SRA Experiments (9) and Runs (9)

Total: 59949 MB
SRX368216 SRP032164 RNA-Seq SINGLE
GSM1251885: MP98; Mus musculus; RNA-Seq
Sample: SRS494258
BioProject: PRJNA224741
BioSample: SAMN02384535
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
strain: C57BL/6
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: No ASO Treatment - 10ul of saline was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017123 208577997 10428899850 6553.11 MP98.fastq.gz, SRR1017123 SRA
SRX368217 SRP032164 RNA-Seq SINGLE
GSM1251886: MP99; Mus musculus; RNA-Seq
Sample: SRS494257
BioProject: PRJNA224741
BioSample: SAMN02384537
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
strain: C57BL/6
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: No ASO Treatment - 10ul of saline was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017124 202227142 10111357100 6294.43 MP99.fastq.gz, SRR1017124 SRA
SRX368218 SRP032164 RNA-Seq SINGLE
GSM1251887: MP100; Mus musculus; RNA-Seq
Sample: SRS494259
BioProject: PRJNA224741
BioSample: SAMN02384539
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
strain: C57BL/6
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: No ASO Treatment - 10ul of saline was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017125 233496012 11674800600 7528.4 MP100.fastq.gz, SRR1017125 SRA
SRX368219 SRP032164 RNA-Seq SINGLE
GSM1251888: MP101; Mus musculus; RNA-Seq
Sample: SRS494260
BioProject: PRJNA224741
BioSample: SAMN02384538
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
strain: C57BL/6
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: Treatment with 500 ug of a control ASO (#456835) - 10ul of ASO solution was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017126 209990065 10499503250 6313.79 MP101.fastq.gz, SRR1017126 SRA
SRX368220 SRP032164 RNA-Seq SINGLE
GSM1251889: MP102; Mus musculus; RNA-Seq
Sample: SRS494261
BioProject: PRJNA224741
BioSample: SAMN02384536
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
strain: C57BL/6
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: Treatment with 500 ug of a control ASO (#456835) - 10ul of ASO solution was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017127 200179835 10008991750 6249.74 MP102.fastq.gz, SRR1017127 SRA
SRX368221 SRP032164 RNA-Seq SINGLE
GSM1251890: MP103; Mus musculus; RNA-Seq
Sample: SRS494262
BioProject: PRJNA224741
BioSample: SAMN02384540
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: Treatment with 500 ug of a control ASO (#456835) - 10ul of ASO solution was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017128 183681794 9184089700 5630.06 MP103.fastq.gz, SRR1017128 SRA
SRX368222 SRP032164 RNA-Seq SINGLE
GSM1251891: MP107; Mus musculus; RNA-Seq
Sample: SRS494263
BioProject: PRJNA224741
BioSample: SAMN02384541
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
strain: C57BL/6
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: Treatment with 500 ug of a mouse C9orf72 ASO (#571883) - 10ul of ASO solution was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017129 218751586 10937579300 7084.43 MP107.fastq.gz, SRR1017129 SRA
SRX368223 SRP032164 RNA-Seq SINGLE
GSM1251892: MP108; Mus musculus; RNA-Seq
Sample: SRS494264
BioProject: PRJNA224741
BioSample: SAMN02384542
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
strain: C57BL/6
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: Treatment with 500 ug of a mouse C9orf72 ASO (#571883) - 10ul of ASO solution was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017130 223912963 11195648150 6844.05 MP108.fastq.gz, SRR1017130 SRA
SRX368224 SRP032164 RNA-Seq SINGLE
GSM1251893: MP109; Mus musculus; RNA-Seq
Sample: SRS494265
BioProject: PRJNA224741
BioSample: SAMN02384543
Platform: ILLUMINA
Instrument: Illumina HiSeq 2000
Organism: Mus musculus
Sample attributes
source_name: C57Bl/6 mice
tissue: Spinal cord
strain: C57BL/6
gender: female
age: 10 weeks
genotype: wild-type
drug treatment: Treatment with 500 ug of a mouse C9orf72 ASO (#571883) - 10ul of ASO solution was injected in the right lateral ventricle
Original files (1)
C57Bl/6 mice
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR1017131 239908514 11995425700 7451.16 MP109.fastq.gz, SRR1017131 SRA

Linked Publications (1)

Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration.
Proceedings of the National Academy of Sciences of the United States of America · 2013

Data Files (12)

Accession File Name Stored Type Output Type Mapping Assembly Size Download
— MP100.fastq.gz RNA-Seq 7.4 GB link
— MP101.fastq.gz RNA-Seq 6.2 GB link
— MP102.fastq.gz RNA-Seq 6.1 GB link
— MP103.fastq.gz RNA-Seq 5.5 GB link
— MP107.fastq.gz RNA-Seq 6.9 GB link
— MP108.fastq.gz RNA-Seq 6.7 GB link
— MP109.fastq.gz RNA-Seq 7.3 GB link
— MP98.fastq.gz RNA-Seq 6.4 GB link
— MP99.fastq.gz RNA-Seq 6.1 GB link
— SRR1017124 RNA-Seq 6.1 GB link
— SRR1017127 RNA-Seq 6.1 GB link
— SRR1017128 RNA-Seq 5.5 GB link