← All datasets

GSE181140

GSE GEO
View on GEO Export SRA CSV

Identification of the Global miR-130a Targetome Reveals a Novel Role for TBL1XR1 in Hematopoietic Stem Cell Self-Renewal and t(8;21) AML

Organism: Homo sapiens
Platform: GPL16791
Samples: 93
Experiment Types:
Expression profiling by high throughput sequencing Genome binding/occupancy profiling by high throughput sequencing
Submitted: Jul 29 2021
Last Updated: Jul 01 2024
Status: Public on Mar 08 2022
Contact: Alexander,James,Murison (University Health Network)

Relations

SuperSeries of: GSE181136 SuperSeries of: GSE181137 SuperSeries of: GSE181138 SuperSeries of: GSE181139 SuperSeries of: GSE180129 SuperSeries of: GSE196177 BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA750775

Summary

This SuperSeries is composed of the SubSeries listed below.

Overall Design

Refer to individual Series

Analysis (24 steps)

View Data Processing
Processing steps for GSE181140
  1. Sequenced reads were reformatted to include randomers in read headers with umi_tools (1.0.0).
  2. Args: --random-seed 1 --bc-pattern NNNNNNNNNN
  3. Reads were then trimmed with cutadapt (1.14).
  4. Args: --match-read-wildcards -O 1 --times 1 -e 0.1 --quality-cutoff 6 -m 18 -a InvRNA*.fasta (fasta sequences can be found at: https://github.com/YeoLab/eclip/tree/master/example/inputs/)
  5. Reads were then trimmed again with cutadapt (1.14) to remove double-ligation events.
  6. Args: --match-read-wildcards -O 5 --times 1 -e 0.1 --quality-cutoff 6 -m 18 -a Ril19.fasta (fasta sequences can be found at: https://github.com/YeoLab/eclip/tree/master/example/inputs/)
  7. For targeted miR-130a datasets, reads that did not contain the primer sequence (CAGUGCAAUGUUAAAAGGGCAU) were filtered out.
  8. For total chimeric eCLIP datasets, 10nt from the 3'end of Read1 was trimmed with umi_tools.
Showing first 8 steps.

Supplementary Files (1)

GSE181140_RAW.tar Download
GEO Samples (93)
GSM5453665 GSM5453666 GSM5453667 GSM5453668 GSM5453669 GSM5453670 GSM5470531 GSM5470532 GSM5488509 GSM5488510 GSM5488511 GSM5488513 GSM5488514 GSM5488516 GSM5488517 GSM5488519 GSM5488520 GSM5488521 GSM5488523 GSM5488524 GSM5488525 GSM5488527 GSM5488528 GSM5488529 GSM5488531 GSM5488532 GSM5488563 GSM5488565 GSM5488566 GSM5488567 GSM5488568 GSM5488570 GSM5488579 GSM5488581 GSM5488582 GSM5488583 GSM5488584 GSM5488586 GSM5488597 GSM5488598 GSM5488600 GSM5488601 GSM5488602 GSM5488604 GSM5733559 GSM5862049 GSM5862050 GSM5862051 GSM5862052 GSM5862053 GSM5862054 GSM5862055 GSM5862056 GSM5862057 GSM5862058 GSM5862059 GSM5862060 GSM5862061 GSM5862062 GSM5862063 GSM5862064 GSM5862065 GSM5862066 GSM5862067 GSM5862068 GSM5862069 GSM5862070 GSM5862071 GSM5862072 GSM5862073 GSM5862074 GSM5862075 GSM5862076 GSM5862077 GSM5862078 GSM5862079 GSM5862080 GSM5862081 GSM5862082 GSM5862083 GSM5862084 GSM5862085 GSM5862086 GSM5862087 GSM5862088 GSM5862089 GSM5862090 GSM5862091 GSM5862092 GSM5862093 GSM5862094 GSM5862095 GSM5862096

Dataset Citations (1)

Identification of the global miR-130a targetome reveals a role for TBL1XR1 in hematopoietic stem cell self-renewal and t(8;21) AML.
PMID 35263585 · 2022 · Cell reports
Gabriela Krivdova, Veronique Voisin, Erwin M Schoof, Sajid A Marhon, Alex Murison, Jessica L McLeod, Martino M Gabra, Andy G X Zeng, Stefan Aigner, Brian A Yee, Alexander A Shishkin, Eric L Van Nostrand, Karin G Hermans, Aaron C Trotman-Grant, Nathan Mbong, James A Kennedy, Olga I Gan, Elvin Wagenblast, Daniel D De Carvalho, Leonardo Salmena, Mark D Minden, Gary D Bader, Gene W Yeo, John E Dick, Eric R Lechman

Linked Publications (1)

Identification of the global miR-130a targetome reveals a role for TBL1XR1 in hematopoietic stem cell self-renewal and t(8;21) AML.
Cell reports · 2022