← All datasets

GSE127743

GSE GEO
View on GEO Export SRA CSV

In vivo CRISPR screening unveils RNA binding protein dependencies for leukemic stem cells and identifies ELAVL1 as a potential therapeutic target [RNA-seq]

Organism: Mus musculus
Platform: GPL18480
Samples: 4
Experiment Types:
Expression profiling by high throughput sequencing
Submitted: Mar 02 2019
Last Updated: Jan 19 2023
Status: Public on Jan 18 2023
Contact: Gene,,Yeo (UCSD)

Relations

BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA525226 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP187330

Summary

RNA binding protein (RBP)-directed post-transcriptional control of stem cell fate represents an underexplored mechanism driving hematopoietic stemness and transformation. We show that a unique set of RBPs are specifically enriched in leukemic stem cells (LSCs) of human primary acute myeloid leukemia (AML) but repressed in normal hematopoietic stem cells. Using an in vivo CRISPR-Cas9-mediated screening approach, we identify 33 key RBPs specifically essential for LSC-mediated MLL-AF9/NrasG12D AML. Knock-down/genetic ablation of the hit RBP Elavl1 in genetically distinct leukemias significantly reduced LSC numbers, and hampered leukemic engraftment. In human AML we show impairment of LSC-driven in vivo leukemic reconstitution and selective depletion of AML progenitors upon ELAVL1 targeting, highlighting the potential clinical importance of our findings. Profiling of the leukemic ELAVL1-mRNA interactome revealed hematopoietic differentiation, RNA splicing and mitochondrial metabolism as major pathways impacted by ELAVL1. Altogether, this work demonstrates that Elavl1 and other RBPs are critical regulators of LSC-survival and self-renewal.

Overall Design

2x sgNTC, 2x sgELAVL1; Cells were transduced with lentiviral-packaged sgRNA targeting Elavl1 and, as control, Ano9. 72 hours following transduction live 7AAD- GFP+ cells were isolated.

Analysis (4 steps)

View Data Processing
Processing steps for GSE127743
  1. Raw reads were trimmed using cutadapt (v1.14) using the following parameters: -O 5 --match-read-wildcards --times 2 -e 0.0 --quality-cutoff 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG ATCTCGTATGCCGTCTTCTGCTTG CGACAGGTTCAGAGTTCTACAGTCCGACGATC GATCGGAAGAGCACACGTCTGAACTCCAGTCAC AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
  2. Trimmed reads were mapped to and filtered of mouse-specific repeat elements (RepBase 18.05) with STAR (2.4.0i) using the following parameters: --alignEndsType EndToEnd --genomeDir repbase --genomeLoad NoSharedMemory --outBAMcompression 10 --outFileNamePrefix condition1 --outFilterMultimapNmax 10 --outFilterMultimapScoreRange 1 --outFilterScoreMin 10 --outFilterType BySJout --outReadsUnmapped Fastx --outSAMattrRGline ID:foo --outSAMattributes All --outSAMmode Full --outSAMtype BAM Unsorted --outSAMunmapped Within --outStd Log --readFilesIn r1.fastq r2.fastq --runMode alignReads --runThreadN 8
  3. Reads unmapped to repeat elements were mapped to the mouse genome with STAR using the same parameters as the previous step, using an mm9 index in place of the repeat element index
  4. Subread featureCounts (-a gencode.vM1.annotation.gtf -s 2 -p -o counts.txt RN2c.bam) was used to count features using mouse annotations (Gencode vM1)

Supplementary Files (2)

GSE127743_RAW.tar Download
GSE127743_counts.RN2c.txt.gz Download
GEO Samples (4)

SRA Experiments (4) and Runs (4)

Total: 14062 MB
SRX5454254 SRP187330 RNA-Seq PAIRED
GSM3638031: sgElavl1 rep1; Mus musculus; RNA-Seq
Sample: SRS4430052
BioProject: PRJNA525226
BioSample: SAMN11043110
Platform: ILLUMINA
Instrument: Illumina HiSeq 1500
Organism: Mus musculus
Sample attributes
source_name: RN2c_sgElavl1
cell line: RN2c
cell type: murine MLL-AF9/NrasG12D acute myeloid leukemia cell line
genotype/variaton: transduced with lentiviral-packaged sgRNA targeting Elavl1
Original files (1)
RN2c_sgElavl1
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR8656542 34265485 6921627970 3583.32 SRR8656542, SRR8656542.lite SRA
SRX5454255 SRP187330 RNA-Seq PAIRED
GSM3638032: sgElavl1 rep2; Mus musculus; RNA-Seq
Sample: SRS4430053
BioProject: PRJNA525226
BioSample: SAMN11043161
Platform: ILLUMINA
Instrument: Illumina HiSeq 1500
Organism: Mus musculus
Sample attributes
source_name: RN2c_sgElavl1
cell line: RN2c
cell type: murine MLL-AF9/NrasG12D acute myeloid leukemia cell line
genotype/variaton: transduced with lentiviral-packaged sgRNA targeting Elavl1
Original files (1)
RN2c_sgElavl1
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR8656543 36245947 7321681294 3806.72 SRR8656543, SRR8656543.lite SRA
SRX5454256 SRP187330 RNA-Seq PAIRED
GSM3638033: sgControl rep1; Mus musculus; RNA-Seq
Sample: SRS4430054
BioProject: PRJNA525226
BioSample: SAMN11043160
Platform: ILLUMINA
Instrument: Illumina HiSeq 1500
Organism: Mus musculus
Sample attributes
source_name: RN2c_sgControl
cell line: RN2c
cell type: murine MLL-AF9/NrasG12D acute myeloid leukemia cell line
genotype/variaton: transduced with lentiviral-packaged sgRNA control
Original files (1)
RN2c_sgControl
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR8656544 33487256 6764425712 3490.88 SRR8656544, SRR8656544.lite SRA
SRX5454257 SRP187330 RNA-Seq PAIRED
GSM3638034: sgControl rep2; Mus musculus; RNA-Seq
Sample: SRS4430055
BioProject: PRJNA525226
BioSample: SAMN11043159
Platform: ILLUMINA
Instrument: Illumina HiSeq 1500
Organism: Mus musculus
Sample attributes
source_name: RN2c_sgControl
cell line: RN2c
cell type: murine MLL-AF9/NrasG12D acute myeloid leukemia cell line
genotype/variaton: transduced with lentiviral-packaged sgRNA control
Original files (1)
RN2c_sgControl
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR8656545 30209390 6102296780 3181.5 SRR8656545, SRR8656545.lite SRA

Linked Publications (1)

Data Files (4)

Accession File Name Stored Type Output Type Mapping Assembly Size Download
SRR8656542 RNA-Seq 3.5 GB link
SRR8656543 RNA-Seq 3.7 GB link
SRR8656544 RNA-Seq 3.4 GB link
SRR8656545 RNA-Seq 3.1 GB link