← All datasets

GSE98869

GSE GEO
View on GEO Export SRA CSV

The C. elegans neural editome reveals an ADAR target mRNA required for proper chemotaxis

Organism: 6239
Platform: GPL19757
Samples: 6
Experiment Types:
Expression profiling by high throughput sequencing
Submitted: May 12 2017
Last Updated: May 15 2019
Status: Public on Jun 13 2017
Contact: Gene,,Yeo (UCSD)

Relations

BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA386479 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP106988

Summary

ADAR proteins alter gene expression both via catalyzing adenosine-to-inosine RNA editing and in an editing-independent manner by binding to target RNAs. Loss of ADARs affects neuronal function in all animals studied to date. To identify important neuronal targets in C. elegans, we performed the first unbiased assessment of the effects of ADR-2, the C. elegans editing enzyme, on the neural transcriptome. We identified the neural editome and gene expression changes associated with the loss of adr-2. As C. elegans lacking adr-2 exhibit reduced chemotaxis, our studies focused on targets that regulate this process. We identified an edited mRNA, clec-41, whose expression is dependent on ADR-2. Expressing clec-41 in adr-2 deficient neural cells restored chemotaxis. This study is the first of its kind in the RNA editing field to span from developing novel methodology for tissue-specific target identification to organismal behavior, significantly advancing our understanding of ADAR functions in neural cells.

Overall Design

Strand-specific editing sites and differential expression analysis was done on triplicate WT (wildtype) and Adr2- (control) C. elegans neural cells.

Analysis (13 steps)

View Data Processing
Processing steps for GSE98869
  1. Reads were trimmed of adapter sequences TCGTATGCCGTCTTCTGCTTG, ATCTCGTATGCCGTCTTCTGCTTG, CGACAGGTTCAGAGTTCTACAGTCCGACGATC GATCGGAAGAGCACACGTCTGAACTCCAGTCAC using cutadapt v1.9.1
  2. Trimmed reads were aligned to RepBase v18.05 using STAR v2.4.01
  3. Reads that didn't align to RepBase were aligned to ce11 using STAR v2.4.01
  4. Featurecounts v1.5.0-p1 and DESeq2 were used to count and normalize genes for differential expression, respectively.
  5. Gene regions were described using WS254 (Wormbase) annotations.
  6. Reads were removed of potential duplicates and combined respective to their WT or Adr condition for editing calls using samtools v1.3.1
  7. Reads were filtered and removed using the following parameters: reads containing junction overhangs less than 10nt long, reads containing indels, reads containing mutations within 5nt of the 3' end, reads containing more than 1 non AG or TC antisense mutation
  8. Reads were piled up using samtools 1.3.1 [-d 1000 -E -I -p -o -f -t DP,DV,DPR,INFO/DPR,DP4,SP]
Showing first 8 steps.

Supplementary Files (2)

GSE98869_diffexp.tsv.gz Download
GSE98869_editing_calls.tsv.gz Download
GEO Samples (6)
GSM2616947 GSM2616948 GSM2616949 GSM2616950 GSM2616951 GSM2616952

SRA Experiments (6) and Runs (6)

Total: 11420 MB
SRX2804304 SRP106988 RNA-Seq SINGLE
GSM2616947: WT_1; Caenorhabditis elegans; RNA-Seq
Sample: SRS2184486
BioProject: PRJNA386479
BioSample: SAMN06956348
Platform: ILLUMINA
Instrument: NextSeq 500
Organism: Caenorhabditis elegans
Sample attributes
source_name: WT
cell type: Neural cells
Original files (1)
WT
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR5534733 39174844 6072100820 2133.74 GSF973-Hundley-SarahD-1_S1_R1_001.fastq.gz, SRR5534733, SRR5534733.sr… SRA
SRX2804305 SRP106988 RNA-Seq SINGLE
GSM2616948: Adr2-_2; Caenorhabditis elegans; RNA-Seq
Sample: SRS2184487
BioProject: PRJNA386479
BioSample: SAMN06956346
Platform: ILLUMINA
Instrument: NextSeq 500
Organism: Caenorhabditis elegans
Sample attributes
source_name: Adr2-
cell type: Neural cells
Original files (1)
Adr2-
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR5534734 16824586 2607810830 948.21 GSF973-Hundley-SarahD-2_S2_R1_001.fastq.gz, SRR5534734, SRR5534734.sr… SRA
SRX2804306 SRP106988 RNA-Seq SINGLE
GSM2616949: WT_3; Caenorhabditis elegans; RNA-Seq
Sample: SRS2184488
BioProject: PRJNA386479
BioSample: SAMN06956345
Platform: ILLUMINA
Instrument: NextSeq 500
Organism: Caenorhabditis elegans
Sample attributes
source_name: WT
cell type: Neural cells
Original files (1)
WT
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR5534735 27612752 4279976560 1544.51 SRR5534735, SRR5534735.sralite, GSF973-Hundley-SarahD-3_S3_R1_001.fas… SRA
SRX2804307 SRP106988 RNA-Seq SINGLE
GSM2616950: Adr2-_5; Caenorhabditis elegans; RNA-Seq
Sample: SRS2184489
BioProject: PRJNA386479
BioSample: SAMN06956344
Platform: ILLUMINA
Instrument: NextSeq 500
Organism: Caenorhabditis elegans
Sample attributes
source_name: Adr2-
cell type: Neural cells
Original files (1)
Adr2-
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR5534736 34080132 5282420460 1906.31 SRR5534736.sralite, SRR5534736, GSF973-Hundley-SarahD-5_S5_R1_001.fas… SRA
SRX2804308 SRP106988 RNA-Seq SINGLE
GSM2616951: WT_6; Caenorhabditis elegans; RNA-Seq
Sample: SRS2184490
BioProject: PRJNA386479
BioSample: SAMN06956343
Platform: ILLUMINA
Instrument: NextSeq 500
Organism: Caenorhabditis elegans
Sample attributes
source_name: WT
cell type: Neural cells
Original files (1)
WT
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR5534737 38659785 5992266675 2144.61 GSF973-Hundley-SarahD-6_S6_R1_001.fastq.gz, SRR5534737, SRR5534737.sr… SRA
SRX2804309 SRP106988 RNA-Seq SINGLE
GSM2616952: Adr2-_7; Caenorhabditis elegans; RNA-Seq
Sample: SRS2184491
BioProject: PRJNA386479
BioSample: SAMN06956342
Platform: ILLUMINA
Instrument: NextSeq 500
Organism: Caenorhabditis elegans
Sample attributes
source_name: Adr2-
cell type: Neural cells
Original files (1)
Adr2-
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR5534738 48877529 7576016995 2742.93 GSF973-Hundley-SarahD-7_S7_R1_001.fastq.gz, SRR5534738, SRR5534738.sr… SRA

Linked Publications (1)

The <i>C. elegans</i> neural editome reveals an ADAR target mRNA required for proper chemotaxis.
eLife · 2017

Data Files (6)

Accession File Name Stored Type Output Type Mapping Assembly Size Download
— GSF973-Hundley-SarahD-1_S1_R1_001.fastq.gz RNA-Seq 2.1 GB link
— GSF973-Hundley-SarahD-2_S2_R1_001.fastq.gz RNA-Seq 948.2 MB link
— GSF973-Hundley-SarahD-6_S6_R1_001.fastq.gz RNA-Seq 2.1 GB link
— GSF973-Hundley-SarahD-7_S7_R1_001.fastq.gz RNA-Seq 2.7 GB link
— SRR5534735 RNA-Seq 1.5 GB link
— SRR5534736.sralite RNA-Seq 1.9 GB link