GSE77703 Processing Pipeline

RNA-Seq code_examples 5 steps

Publication

Distinct and shared functions of ALS-associated proteins TDP-43, FUS and TAF15 revealed by multisystem analyses.

Nature communications (2016) — PMID 27378374

Dataset

GSE77703

Distinct and shared functions of ALS-associated TDP-43, FUS, and TAF15 revealed by comprehensive multi-system integrative analyses [RNA-Seq_mouse]

Warning: Pipeline descriptions and code snippets may be inferred or AI-generated. Use them only as a starting point to guide analysis, and validate before use.

Processing Steps

Generate Jupyter Notebook
  1. 1

    Sequencing reads from RNA-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.

    cutadapt
  2. 2

    Reads were then mapped against a database of repetitive elements derived from RepBase18.05.

  3. 3

    Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).

    Bowtie v1.0.0
  4. 4

    Reads not mapped to Repbase sequences were aligned to the mm9 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1.

    STAR
  5. 5

    counts of reads for each gene annotated in gencode vM1 were calculated from featureCounts

    featureCounts

Tools Used

STAR
Raw Source Text 
Sequencing reads from RNA-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
Reads were then mapped against a database of repetitive elements derived from RepBase18.05. Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
Reads not mapped to Repbase sequences were aligned to the mm9 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1.
counts of reads for each gene annotated in gencode vM1 were calculated from featureCounts
Genome_build: mm9
Supplementary_files_format_and_content: count file, contains counts of reads for each sample
← Back to Analysis