GSE77703
GSE GEODistinct and shared functions of ALS-associated TDP-43, FUS, and TAF15 revealed by comprehensive multi-system integrative analyses [RNA-Seq_mouse]
Relations
Summary
TDP-43, FUS, and TAF15 are implicated in amyotrophic lateral sclerosis (ALS) and frontotemporal dementia. We integrate CLIP-seq and RNA Bind-N-Seq technologies to discover that TAF15 binds to ~4,900 RNAs enriched for GGUA motifs. In the mouse brain, TAF15 and FUS, but not TDP-43, exhibit strikingly similar RNA binding profiles, yet they alter the expression of distinct mRNA populations upon their individual depletions. TAF15 has a minimal role in alternative splicing and instead affects RNA turnover, consistent with an enrichment of TAF15 binding sites in 3â untranslated regions. In human stem cell-derived motor neurons, loss of both TAF15 and FUS affected mRNAs distinct from those altered by loss of either protein alone, revealing redundant roles for TAF15 and FUS in maintaining mRNA levels. Furthermore, concomitant rather than individual depletion of TAF15 and FUS more closely resembles RNA profiles of motor neurons derived from FUS R521G ALS patients or from late-stage, sporadic ALS patients. Our study reveals convergent and divergent mechanisms by which FUS, TAF15 and TDP-43 affects RNA metabolism in neurological disease.
Overall Design
RNA-seq, CLIP-seq and arrays in mouse and human against TAF15 knockdowns This Series represents RNA-seq sample(s).
Analysis (5 steps)
View Data Processing- Sequencing reads from RNA-seq libraries were first trimmed of polyA tails, adapters, and low quality ends using cutadapt with parameters --match-read-wildcards --times 2 -e 0 -O 5 --quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.
- Reads were then mapped against a database of repetitive elements derived from RepBase18.05.
- Bowtie version 1.0.0 with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2009).
- Reads not mapped to Repbase sequences were aligned to the mm9 human genome (UCSC assembly) using STAR (Dobin et al., 2013) version 2.3.0e with parameters --outSAMunmapped Within âoutFilterMultimapNmax 1 âoutFilterMultimapScoreRange 1.
- counts of reads for each gene annotated in gencode vM1 were calculated from featureCounts
Supplementary Files (1)
GEO Samples (4)
Dataset Citations (1)
SRA Experiments (4) and Runs (4)
Total: 4294 MBSample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR3153279 | 36541327 | 1827066350 | 1110.75 | KK7.fastq.gz, SRR3153279, SRR3153279.sralite | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR3153280 | 37380816 | 1869040800 | 1147.96 | KK8.fastq.gz, SRR3153280, SRR3153280.sralite | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR3153281 | 31065321 | 1553266050 | 942.18 | KK1.fastq.gz, SRR3153281, SRR3153281.sralite | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR3153282 | 35091331 | 1754566550 | 1093.52 | KK2.fastq.gz, SRR3153282, SRR3153282.sralite | SRA |
Linked Publications (1)
Data Files (8)
| Accession | File Name | Stored Type | Output Type | Mapping Assembly | Size | Download | |
|---|---|---|---|---|---|---|---|
| — | KK1.fastq.gz | RNA-Seq | 942.2 MB | link | |||
| — | KK1.fastq.gz | RNA-Seq | 942.2 MB | link | |||
| — | KK2.fastq.gz | RNA-Seq | 1.1 GB | link | |||
| — | KK2.fastq.gz | RNA-Seq | 1.1 GB | link | |||
| — | KK7.fastq.gz | RNA-Seq | 1.1 GB | link | |||
| — | KK7.fastq.gz | RNA-Seq | 1.1 GB | link | |||
| — | KK8.fastq.gz | RNA-Seq | 1.1 GB | link | |||
| — | KK8.fastq.gz | RNA-Seq | 1.1 GB | link |