GSE90963

Transcriptome-wide Profiling of Multiple RNA Modifications Simultaneously at Single-base Resolution

1. Reference genome: Novoindex (2.8) (http://www.novocraft.com) was used to create a standard and bisulfite reference index on a combination of hg19 chromosome, scaffold and splice junction sequences.
2. Splice junction sequences were generated with USeq (v8.8.8) 1 MakeTranscriptome using Ensembl transcript annotations (build 74).
3. Alignment parameters: BS and NBS samples were aligned to the transcriptome indexes described above using Novoalign (v2.08.01) (http://www.novocraft.com) allowing up to 50 alignments and trimming adaptor sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC GATCGTCGGACTGTAGAACTCTGAAC).
4. Alignment processing : The alignment files were processed with USeq SamTranscriptomeParser, which reports the best alignment location for each read in bam format and converts the coordinates of splice junction alignments to genomic space.
5. One alignment location is selected at random if a read aligned to multiple locations in the genome with equal confidence.
6. Alignments were reordered using Picard (v1.87) (http://picard.sourceforge.net) ReorderBam and all alignments were set as primary using the set_sam_primary.py (https://github.com/HuntsmanCancerInstitute/RBSSeqTools).
7. The alignments were then processed with GATK (v3.4-0) 2 SplitNCigarReads, which splits spliced alignments into multiple alignment segments without N cigar elements.
8. Reads containing deletions four base pairs or longer were removed using remove_deletions.py (https://github.com/HuntsmanCancerInstitute/RBSSeqTools).

Supplementary Files (4)

Dataset Citations (1)

Linked Publications (1)