GSE173507
GSE GEODiscovery and functional interrogation of the virus and host RNA interactome of SARS-CoV-2 proteins [RNA-Seq]
Relations
Summary
The coronavirus disease 2019 (COVID-19) pandemic was caused by severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2). Understanding the molecular functions of SARS-CoV-2 proteins is thus imperative to developing effective antiviral treatments. Here, we use enhanced crosslinking and immunoprecipitation to investigate SARS-CoV-2 protein interactions with viral and host RNAs. SARS-CoV-2 proteins, NSP8 and NSP12, are found to specifically bind to untranslated regions of the RNA viral genome, with NSP12 additionally binding to all transcription regulatory sequences. This provides evidence for their central roles in replication and transcription. Moreover, we discovered a potential site of NSP12 mediated genome recombination, which could explain the genetic diversity found in coronaviruses. SARS-CoV-2 proteins exogenously expressed in human lung epithelial cells bind to 4,281 unique host RNAs. Nine SARS-CoV-2 proteins upregulate target gene expression, including NSP12 which upregulates mitochondrial electron transport and N-linked glycosylation proteins. Furthermore, siRNA knockdown of NSP12-targeted proteins in human lung organoid cells demonstrates substantial antiviral effects. Conversely, NSP9 inhibits host gene expression via blocking mRNA export and dampens antiviral inflammation response such as interleukin 1α (IL1α) production. Our extensive viral protein-RNA interactome provides a catalog of potential therapeutic targets and offers insight into the etiology of COVID-19 as a safeguard against future pandemics.
Overall Design
Vero E6 and A549-ACE2 cells were treated with 1µg/ml doxycyline and infected with SARS-CoV-2 at MOI 0.1 and MOI 3, respectively, for 48 hours before treating with Trizol. BEAS-2B cells were treated with Trizol when 70-90% confluent.
Analysis (4 steps)
View Data Processing- Raw reads were trimmed using cutadapt (v1.14) using the following parameters -O 5 -f fastq --match-read-wildcards --times 2 -e 0.0 --quality-cutoff 6 -m 18 -o data.fastqTr.fq -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT data.fastq.gz
- Trimmed reads were mapped to and filtered of repeat elements (RepBase 18.05) with STAR (2.5.2) using the following parameters: --alignEndsType EndToEnd --genomeDir repbase --genomeLoad NoSharedMemory --outBAMcompression 10 --outFileNamePrefix data --outFilterMultimapNmax 10 --outFilterMultimapScoreRange 1 --outFilterScoreMin 10 --outFilterType BySJout --outReadsUnmapped Fastx --outSAMattrRGline ID:foo --outSAMattributes All --outSAMmode Full --outSAMtype BAM Unsorted --outSAMunmapped Within --outStd Log --readFilesIn data.fastqTr.fq --runMode alignReads --runThreadN 8
- Reads unmapped to repeat elements were mapped to the human genome with STAR using the same parameters as the previous step, using an hg19/ChlSab2 index in place of the repeat element index
- Subread featureCounts (-a gencode.v19.annotation.gtf -s 2 -p -o counts.txt data.bam) was used to count features using human annotations (Gencode v19)
Supplementary Files (1)
GEO Samples (4)
Dataset Citations (2)
SRA Experiments (4) and Runs (4)
Total: 33252 MBSample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR14346737 | 185680758 | 37507513116 | 11995.96 | A549-APO-moi-3_S9_L004_R1_001.fastq.gz, A549-APO-moi-3_S9_L004_R2_001… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR14346738 | 225394905 | 45529770810 | 14496.05 | Veros-APO-moi-0p1_S1_L004_R1_001.fastq.gz, Veros-APO-moi-0p1_S1_L004_… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR14346739 | 9881467 | 1996056334 | 635.43 | WT-1__S34_L004_R1_001.fastq.gz, WT-1__S34_L004_R2_001.fastq.gz, SRR14… | SRA |
Sample attributes
Original files (1)
Runs (1)
| Run | Spots | Bases | Size (MB) | Files | Link |
|---|---|---|---|---|---|
| SRR14346740 | 95805410 | 19352692820 | 6124.44 | WT-2_S21_L004_R1_001.fastq.gz, WT-2_S21_L004_R2_001.fastq.gz, SRR1434… | SRA |
Linked Publications (2)
Data Files (4)
| Accession | File Name | Stored Type | Output Type | Mapping Assembly | Size | Download | |
|---|---|---|---|---|---|---|---|
| — | A549-APO-moi-3_S9_L004_R1_001.fastq.gz | RNA-Seq | 11.7 GB | link | |||
| — | Veros-APO-moi-0p1_S1_L004_R1_001.fastq.gz | RNA-Seq | 14.2 GB | link | |||
| — | WT-1__S34_L004_R1_001.fastq.gz | RNA-Seq | 635.4 MB | link | |||
| — | WT-2_S21_L004_R1_001.fastq.gz | RNA-Seq | 6.0 GB | link |