← All datasets

GSE173507

GSE GEO
View on GEO Export SRA CSV

Discovery and functional interrogation of the virus and host RNA interactome of SARS-CoV-2 proteins [RNA-Seq]

Organism: Homo sapiens
Platform: GPL24676
Samples: 4
Experiment Types:
Expression profiling by high throughput sequencing
Submitted: Apr 28 2021
Last Updated: Mar 31 2022
Status: Public on Mar 09 2022
Contact: Gene,,Yeo (UCSD)

Relations

SubSeries of: GSE173508 BioProject: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA725867 SRA: https://www.ncbi.nlm.nih.gov/sra?term=SRP316753

Summary

The coronavirus disease 2019 (COVID-19) pandemic was caused by severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2). Understanding the molecular functions of SARS-CoV-2 proteins is thus imperative to developing effective antiviral treatments. Here, we use enhanced crosslinking and immunoprecipitation to investigate SARS-CoV-2 protein interactions with viral and host RNAs. SARS-CoV-2 proteins, NSP8 and NSP12, are found to specifically bind to untranslated regions of the RNA viral genome, with NSP12 additionally binding to all transcription regulatory sequences. This provides evidence for their central roles in replication and transcription. Moreover, we discovered a potential site of NSP12 mediated genome recombination, which could explain the genetic diversity found in coronaviruses. SARS-CoV-2 proteins exogenously expressed in human lung epithelial cells bind to 4,281 unique host RNAs. Nine SARS-CoV-2 proteins upregulate target gene expression, including NSP12 which upregulates mitochondrial electron transport and N-linked glycosylation proteins. Furthermore, siRNA knockdown of NSP12-targeted proteins in human lung organoid cells demonstrates substantial antiviral effects. Conversely, NSP9 inhibits host gene expression via blocking mRNA export and dampens antiviral inflammation response such as interleukin 1α (IL1α) production. Our extensive viral protein-RNA interactome provides a catalog of potential therapeutic targets and offers insight into the etiology of COVID-19 as a safeguard against future pandemics.

Overall Design

Vero E6 and A549-ACE2 cells were treated with 1µg/ml doxycyline and infected with SARS-CoV-2 at MOI 0.1 and MOI 3, respectively, for 48 hours before treating with Trizol. BEAS-2B cells were treated with Trizol when 70-90% confluent.

Analysis (4 steps)

View Data Processing
Processing steps for GSE173507
  1. Raw reads were trimmed using cutadapt (v1.14) using the following parameters -O 5 -f fastq --match-read-wildcards --times 2 -e 0.0 --quality-cutoff 6 -m 18 -o data.fastqTr.fq -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA -b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT data.fastq.gz
  2. Trimmed reads were mapped to and filtered of repeat elements (RepBase 18.05) with STAR (2.5.2) using the following parameters: --alignEndsType EndToEnd --genomeDir repbase --genomeLoad NoSharedMemory --outBAMcompression 10 --outFileNamePrefix data --outFilterMultimapNmax 10 --outFilterMultimapScoreRange 1 --outFilterScoreMin 10 --outFilterType BySJout --outReadsUnmapped Fastx --outSAMattrRGline ID:foo --outSAMattributes All --outSAMmode Full --outSAMtype BAM Unsorted --outSAMunmapped Within --outStd Log --readFilesIn data.fastqTr.fq --runMode alignReads --runThreadN 8
  3. Reads unmapped to repeat elements were mapped to the human genome with STAR using the same parameters as the previous step, using an hg19/ChlSab2 index in place of the repeat element index
  4. Subread featureCounts (-a gencode.v19.annotation.gtf -s 2 -p -o counts.txt data.bam) was used to count features using human annotations (Gencode v19)

Supplementary Files (1)

GSE173507_RAW.tar Download
GEO Samples (4)

Dataset Citations (2)

Discovery and functional interrogation of SARS-CoV-2 protein-RNA interactions.
PMID 35233578 · 2022 · bioRxiv : the preprint server for biology
Joy S Xiang, Jasmine R Mueller, En-Ching Luo, Brian A Yee, Danielle Schafer, Jonathan C Schmok, Frederick E Tan, Katherine Rothamel, Rachael N McVicar, Elizabeth M Kwong, Krysten L Jones, Hsuan-Lin Her, Chun-Yuan Chen, Anthony Q Vu, Wenhao Jin, Samuel S Park, Phuong Le, Kristopher W Brannan, Eric R Kofman, Yanhua Li, Alexandra T Tankka, Kevin D Dong, Yan Song, Aaron F Carlin, Eric L Van Nostrand, Sandra L Leibel, Gene W Yeo
Discovery and functional interrogation of SARS-CoV-2 protein-RNA interactions.
PMID 35313591 · 2022 · Research square
Joy S Xiang, Jasmine R Mueller, En-Ching Luo, Brian A Yee, Danielle Schafer, Jonathan C Schmok, Frederick E Tan, Katherine Rothamel, Rachael N McVicar, Elizabeth M Kwong, Ben A Croker, Krysten L Jones, Hsuan-Lin Her, Chun-Yuan Chen, Anthony Q Vu, Wenhao Jin, Samuel S Park, Phuong Le, Kristopher W Brannan, Eric R Kofman, Yanhua Li, Alexandra T Tankka, Kevin D Dong, Yan Song, Alex E Clark, Aaron F Carlin, Eric L Van Nostrand, Sandra L Leibel, Gene W Yeo

SRA Experiments (4) and Runs (4)

Total: 33252 MB
SRX10700587 SRP316753 RNA-Seq PAIRED
GSM5268956: A549-ACE2-APO-moi-3; Homo sapiens; RNA-Seq
Sample: SRS8790514
BioProject: PRJNA725867
BioSample: SAMN18907462
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: A549 cells overexpressing ACE2 and APOBEC1
cell line: A549
agent: SARS-CoV-2
Original files (1)
A549 cells overexpressing ACE2 and APOBEC1
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR14346737 185680758 37507513116 11995.96 A549-APO-moi-3_S9_L004_R1_001.fastq.gz, A549-APO-moi-3_S9_L004_R2_001… SRA
SRX10700588 SRP316753 RNA-Seq PAIRED
GSM5268957: Veros-APO-moi-0p1; Chlorocebus sabaeus; RNA-Seq
Sample: SRS8790515
BioProject: PRJNA725867
BioSample: SAMN18907461
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Chlorocebus sabaeus
Sample attributes
source_name: Vero E6 cells overexpressing APOBEC1
cell line: Vero E6
agent: SARS-CoV-2
Original files (1)
Vero E6 cells overexpressing APOBEC1
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR14346738 225394905 45529770810 14496.05 Veros-APO-moi-0p1_S1_L004_R1_001.fastq.gz, Veros-APO-moi-0p1_S1_L004_… SRA
SRX10700589 SRP316753 RNA-Seq PAIRED
GSM5268958: BEAS-2B WT-1; Homo sapiens; RNA-Seq
Sample: SRS8790516
BioProject: PRJNA725867
BioSample: SAMN18907459
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: BEAS-2B
cell line: BEAS-2B
Original files (1)
BEAS-2B
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR14346739 9881467 1996056334 635.43 WT-1__S34_L004_R1_001.fastq.gz, WT-1__S34_L004_R2_001.fastq.gz, SRR14… SRA
SRX10700590 SRP316753 RNA-Seq PAIRED
GSM5268959: BEAS-2B WT-2; Homo sapiens; RNA-Seq
Sample: SRS8790517
BioProject: PRJNA725867
BioSample: SAMN18907458
Platform: ILLUMINA
Instrument: Illumina NovaSeq 6000
Organism: Homo sapiens
Sample attributes
source_name: BEAS-2B
cell line: BEAS-2B
Original files (1)
BEAS-2B
Runs (1)
Run Spots Bases Size (MB) Files Link
SRR14346740 95805410 19352692820 6124.44 WT-2_S21_L004_R1_001.fastq.gz, WT-2_S21_L004_R2_001.fastq.gz, SRR1434… SRA

Linked Publications (2)

Discovery and functional interrogation of SARS-CoV-2 protein-RNA interactions.
bioRxiv : the preprint server for biology · 2022

Data Files (4)

Accession File Name Stored Type Output Type Mapping Assembly Size Download
A549-APO-moi-3_S9_L004_R1_001.fastq.gz RNA-Seq 11.7 GB link
Veros-APO-moi-0p1_S1_L004_R1_001.fastq.gz RNA-Seq 14.2 GB link
WT-1__S34_L004_R1_001.fastq.gz RNA-Seq 635.4 MB link
WT-2_S21_L004_R1_001.fastq.gz RNA-Seq 6.0 GB link